ID: 1192963803

View in Genome Browser
Species Human (GRCh38)
Location X:76156449-76156471
Sequence CTGTGGCTATTTGAGGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192963801_1192963803 -9 Left 1192963801 X:76156435-76156457 CCAACTACGTAACACTGTGGCTA No data
Right 1192963803 X:76156449-76156471 CTGTGGCTATTTGAGGAAAGTGG No data
1192963799_1192963803 9 Left 1192963799 X:76156417-76156439 CCGGGAAGCTCAGCTTGGCCAAC No data
Right 1192963803 X:76156449-76156471 CTGTGGCTATTTGAGGAAAGTGG No data
1192963797_1192963803 25 Left 1192963797 X:76156401-76156423 CCTTAGGAAGTAATATCCGGGAA No data
Right 1192963803 X:76156449-76156471 CTGTGGCTATTTGAGGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192963803 Original CRISPR CTGTGGCTATTTGAGGAAAG TGG Intergenic
No off target data available for this crispr