ID: 1192965466

View in Genome Browser
Species Human (GRCh38)
Location X:76172725-76172747
Sequence GGTGCTAGGGCGCAGAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 126}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192965466_1192965472 9 Left 1192965466 X:76172725-76172747 CCTGCACTCTGCGCCCTAGCACC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1192965472 X:76172757-76172779 CGTGAATCACTCCCTGGTTTGGG 0: 1
1: 0
2: 0
3: 4
4: 85
1192965466_1192965471 8 Left 1192965466 X:76172725-76172747 CCTGCACTCTGCGCCCTAGCACC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1192965471 X:76172756-76172778 TCGTGAATCACTCCCTGGTTTGG 0: 1
1: 0
2: 0
3: 3
4: 48
1192965466_1192965474 16 Left 1192965466 X:76172725-76172747 CCTGCACTCTGCGCCCTAGCACC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1192965474 X:76172764-76172786 CACTCCCTGGTTTGGGGTACTGG 0: 1
1: 0
2: 3
3: 15
4: 122
1192965466_1192965473 10 Left 1192965466 X:76172725-76172747 CCTGCACTCTGCGCCCTAGCACC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1192965473 X:76172758-76172780 GTGAATCACTCCCTGGTTTGGGG 0: 1
1: 0
2: 1
3: 13
4: 137
1192965466_1192965470 3 Left 1192965466 X:76172725-76172747 CCTGCACTCTGCGCCCTAGCACC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1192965470 X:76172751-76172773 CATTTTCGTGAATCACTCCCTGG 0: 1
1: 0
2: 2
3: 8
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192965466 Original CRISPR GGTGCTAGGGCGCAGAGTGC AGG (reversed) Intergenic
900363565 1:2301403-2301425 AGTGCTCGGGCGCACAGGGCCGG - Intronic
900431342 1:2604551-2604573 GGTGCTGGGGCTCTCAGTGCTGG + Intronic
902518011 1:17000219-17000241 GGAGCTAGGGCCCAGGGGGCGGG - Intronic
902748602 1:18490485-18490507 GGCTCTTGGGGGCAGAGTGCAGG - Intergenic
904437958 1:30511521-30511543 GTTGCTGGGGCACAAAGTGCAGG - Intergenic
906377160 1:45304633-45304655 GGTAATAGGGCTCTGAGTGCTGG - Intronic
912827082 1:112915407-112915429 GTTGCTGGGGCACAGAGAGCAGG + Intronic
914902082 1:151716352-151716374 GGTGCTAGGGCTTAGAGGGCTGG + Exonic
918682212 1:187369526-187369548 GGTGGTAGGGAGCAGAGGGAGGG + Intergenic
922169703 1:223143999-223144021 GGGGGTGGGGCGCAGACTGCAGG + Intergenic
1063005425 10:1965611-1965633 GGTGCTGGGGCGCATGGTGGAGG + Intergenic
1063609850 10:7553188-7553210 GGTACTGGAGGGCAGAGTGCAGG - Intergenic
1064219799 10:13431038-13431060 GGTTCTAGAGGGCAGAGTGAGGG + Intergenic
1064446544 10:15398863-15398885 GGAGCTAGGGCCCAGAATGGGGG - Intergenic
1065854284 10:29816979-29817001 GATGCTGGGGCGCAGGGTGCTGG + Intergenic
1076119141 10:127921888-127921910 GGTGCTGTGGCTCAGGGTGCCGG + Intronic
1076857010 10:133122310-133122332 GGGGCGAGGACGCAGACTGCAGG - Intronic
1078859377 11:15233307-15233329 GCTGTCAGGGGGCAGAGTGCAGG - Intronic
1081831646 11:46120485-46120507 GAAGCCTGGGCGCAGAGTGCAGG - Intronic
1088579421 11:111300462-111300484 GGTGCCAGGGTGCAGAGTGGGGG - Intronic
1089144066 11:116311506-116311528 GGTGCTAGGGCAGAGAGTTGAGG - Intergenic
1093319156 12:17691531-17691553 GGTGGTAGGGTGCAGGGTGAGGG + Intergenic
1094492637 12:30970571-30970593 AGGGCTAGGGTGCAGAGAGCCGG - Intronic
1097687013 12:62700589-62700611 GGTGCTAGGGCTCTGACAGCAGG - Intronic
1098290912 12:68956125-68956147 GGTCCTAGGTGGCAGGGTGCTGG + Intronic
1104958365 12:132476775-132476797 CCTGCCAGGGCGCAGGGTGCGGG - Intergenic
1108142918 13:47444758-47444780 GGTGGTAGGGGGCAGGGGGCAGG + Intergenic
1115442078 14:33447407-33447429 GGAGGTAGGGAGAAGAGTGCCGG + Intronic
1119086495 14:71743997-71744019 GGTGCAAGGGAGCACAATGCTGG - Intergenic
1120834821 14:89030106-89030128 GGGGCCAGGGAGCAGAGAGCAGG - Intergenic
1124439475 15:29675817-29675839 GGTGCAGGGGCGCCGAGGGCTGG - Intergenic
1129247850 15:74290756-74290778 GGTGCTAGGGTGCAGGGTGAGGG + Intronic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1131630584 15:94172998-94173020 GTTGCTAGGGGGCAGAAAGCAGG + Intergenic
1132647820 16:1007184-1007206 GGTGCTGGGGGACAGAGGGCTGG + Intergenic
1132845790 16:2000245-2000267 GGTGGGAGGGCGCTGGGTGCAGG + Exonic
1133224197 16:4332837-4332859 GGTGCTTGGGCCCAGGGTGGTGG + Intronic
1134065659 16:11226348-11226370 GGTCCTGGGGCACAGAGTACAGG + Intergenic
1135134700 16:19879009-19879031 GGAGCTAGGGCTCTGAGTTCCGG - Intronic
1135234178 16:20740452-20740474 GGCACTAGGGGGCAGAGAGCTGG - Intronic
1136399375 16:30009490-30009512 GATGCTACAGTGCAGAGTGCAGG + Exonic
1137783170 16:51114732-51114754 GATACTAGGGTGCTGAGTGCAGG - Intergenic
1138349163 16:56337358-56337380 GGTGCTGGGGAGCAGTGTGTGGG + Intronic
1141108069 16:81249867-81249889 GGTGGGAAGGCCCAGAGTGCGGG + Intronic
1142591065 17:1006326-1006348 GGTGCTACGGGGCAGAGGGTCGG + Intronic
1142636223 17:1259461-1259483 GGAGCCAGGGAGCAGAGTGTGGG + Intergenic
1143125879 17:4640675-4640697 GGAGCAAGGGCGTGGAGTGCGGG + Intronic
1143402600 17:6656147-6656169 GGAGCAAGGGCGTGGAGTGCGGG - Intergenic
1146267488 17:31462549-31462571 GGTGCTAGGAAACTGAGTGCTGG - Intronic
1146795150 17:35775274-35775296 GGGGCAAGGGCTCAGACTGCTGG - Intronic
1147622692 17:41878363-41878385 GGTAGTAGGGAGCAGAGGGCAGG - Intronic
1148090853 17:45021831-45021853 GGTGCTAAGGCCCAAAGTGAGGG + Intergenic
1149440696 17:56671397-56671419 AGTGGCAGGGGGCAGAGTGCAGG - Intergenic
1151942984 17:77304523-77304545 GGTGCTAGGGGGCAGAAGGCAGG + Intronic
1151970763 17:77456375-77456397 GGTGAGAGGGCACAGAGTGGAGG + Intronic
1152352478 17:79791393-79791415 GGTGCGGGAGAGCAGAGTGCGGG - Intergenic
1152714474 17:81891863-81891885 GGTGCGAGGGCGCAGGGGGTGGG + Exonic
1153903394 18:9638632-9638654 GGGGCTTGGGCGCAGAGGGTGGG - Intergenic
1160744502 19:704242-704264 GGGGCTAGGGCGCAGGGGGCGGG + Intergenic
1160933366 19:1581202-1581224 GGTGCTAGTGTGCAGGGCGCTGG + Exonic
1161021933 19:2014896-2014918 GGTGCAGAGGCCCAGAGTGCAGG + Intronic
1161365921 19:3879777-3879799 GATGGTAGGGTGGAGAGTGCAGG - Intergenic
1167337871 19:48897662-48897684 GGGGCTAGGGTGCAGACTTCTGG - Intronic
1168257623 19:55175306-55175328 GGAGCTGGGGGGCAGGGTGCTGG - Exonic
1168332490 19:55578566-55578588 GGGGCGAGGGGGCGGAGTGCGGG - Exonic
924976219 2:178075-178097 GCAGCTAGAGAGCAGAGTGCAGG + Intergenic
925151066 2:1615161-1615183 GGGGCCAGGGTGCAGAGTGCTGG + Intergenic
926154720 2:10447740-10447762 GGTGCAGGGGCGCAGAGCCCGGG - Intronic
927928215 2:27027379-27027401 GGTGGTAGGGCTCTGAGGGCAGG + Intergenic
928384791 2:30857945-30857967 GGAGCTAGAGAGTAGAGTGCTGG + Intergenic
928978086 2:37109878-37109900 GGTGATAGAACTCAGAGTGCTGG + Intronic
932219487 2:69989098-69989120 GGGGATAGGGCCCAGAGGGCAGG + Intergenic
938654978 2:133422071-133422093 TGTGCTAGAGCACAGAGTGCAGG + Intronic
938956661 2:136305251-136305273 GGAGTTAGGGAGCAGAGTGGGGG + Intergenic
939146277 2:138418978-138419000 GGTGCTAGTGCCTAGGGTGCTGG + Intergenic
941164930 2:162074276-162074298 GCAGCCGGGGCGCAGAGTGCGGG + Exonic
942292496 2:174486746-174486768 GGGGCCAGGGCGCAGAGGGTCGG + Intronic
942638034 2:178029906-178029928 GGTGAAAGGGCAAAGAGTGCTGG - Intronic
943060610 2:183038359-183038381 GGGGCTGGGGCGGAGAGCGCCGG - Exonic
946353667 2:219171698-219171720 AGTGCTAGGGCCCAGGGTCCTGG + Intergenic
946947906 2:224841098-224841120 GGGGCTAGGGAGGGGAGTGCTGG + Intronic
947371942 2:229455975-229455997 GGTGCCACAGCACAGAGTGCTGG - Intronic
1170311485 20:14997255-14997277 GGAGCTAGGGCCCAGAATGGGGG - Intronic
1171488639 20:25501245-25501267 GGTGCAAGGCCTCAGAGTCCTGG - Intronic
1173166236 20:40688959-40688981 GGAGCGAGGGCGCAGCGGGCCGG + Exonic
1175460080 20:59145905-59145927 GGTGCAAGGGGAAAGAGTGCAGG + Intergenic
1175787402 20:61720552-61720574 GGTGCAGGGGTGCAGAGTACAGG + Intronic
1179824369 21:43955924-43955946 GTTGCTACGGCGCAAAGTACAGG - Intronic
1179825755 21:43965374-43965396 GGTGCTGCGGCGAAGGGTGCAGG + Intronic
1180071406 21:45438456-45438478 GGTGCCTGGGCACGGAGTGCCGG + Intronic
1180229895 21:46420995-46421017 AGTGCAAGGGTGCAGGGTGCTGG - Intronic
1183605583 22:38865400-38865422 GGTGCTAGGCCCCAGGCTGCCGG - Exonic
1185399354 22:50607937-50607959 GGTGCTGGGACACAGAGGGCAGG - Intronic
951049398 3:18077364-18077386 GGTGATTTGGCCCAGAGTGCAGG + Intronic
953927322 3:46989118-46989140 AGTGCTAGTGCCCCGAGTGCTGG + Exonic
966050916 3:175617318-175617340 GGAGCTAGGGAGAGGAGTGCTGG + Intronic
966650110 3:182291154-182291176 GGTGGTAGGGAGAAGAGTGATGG - Intergenic
968074854 3:195810650-195810672 GCGGCCAGGGCGCAGAGGGCCGG - Intronic
969450661 4:7271231-7271253 GGTGAGAGGGCTCAGAGTGGAGG - Intronic
969673381 4:8601830-8601852 GGAGCCTGGGCTCAGAGTGCAGG + Intronic
970427960 4:15962983-15963005 GCTGCTGGGACGCATAGTGCAGG + Exonic
983266189 4:165510710-165510732 GGTGCCAGAGGGCAGATTGCTGG + Intergenic
983513703 4:168635295-168635317 GATGCTAGGGCTCAGAGACCAGG + Intronic
985471253 5:48267-48289 GCTGCTGGGGAGCAGAGTGAAGG + Intergenic
985613950 5:908194-908216 GGTGGAAAGGCGCACAGTGCAGG - Intronic
987823067 5:22991209-22991231 GGAGCTAGGGCCCAGAATGAGGG - Intergenic
992638594 5:78749093-78749115 GATGATAGGGGGCAGAGTGGTGG + Intronic
997459812 5:134044280-134044302 GGAGCTAGGGCGGAAAGAGCTGG - Intergenic
997511377 5:134457135-134457157 GGTGCTAGGGGGCTGAATTCAGG + Intergenic
999459473 5:151745519-151745541 GGTTCCAGAGCGAAGAGTGCTGG + Intronic
1003224044 6:4188960-4188982 GGTGCCAGGGCGCAGTGGGAAGG + Intergenic
1003235875 6:4294843-4294865 GGTGGTAGGGTGCAGAGAGATGG - Intergenic
1003235890 6:4294920-4294942 GGTGGTAGGGTGCAGAGAGATGG - Intergenic
1003837472 6:10087352-10087374 TGTGTTGGGGTGCAGAGTGCAGG - Intronic
1006423734 6:33951054-33951076 GATGCCAGGGAGGAGAGTGCTGG + Intergenic
1006831383 6:36970311-36970333 GGTGGGAGGGGGCAGAGTGCTGG + Intronic
1007313282 6:40963692-40963714 GGTGCAGGGGCTCAGACTGCTGG + Intergenic
1013860330 6:114628045-114628067 GGTGCAAGTGCACAGTGTGCAGG + Intergenic
1019685529 7:2379919-2379941 GGGGCTGGGGAGCAGAGTGCGGG + Intronic
1024023627 7:45392247-45392269 GGTGCTAGCGCGCTGCGTGGTGG + Intergenic
1024683315 7:51717293-51717315 GATGTTAGGGGGCAGAGGGCTGG + Intergenic
1030304160 7:108002622-108002644 GGGGCTTGGGCGCAGAGCCCGGG + Intronic
1030462178 7:109853407-109853429 GTTGCTAGAGCACAGTGTGCTGG - Intergenic
1041201090 8:55452433-55452455 GGTGCGAGGGCGGGCAGTGCGGG - Intronic
1042690948 8:71498040-71498062 GGTGGTTGGGGGCAGAGTGGAGG + Intronic
1049602855 8:143515939-143515961 GATGCTAGGGTGCTGAGTGTGGG - Intronic
1049613744 8:143567543-143567565 GGTGCTAGGGCGGAGTGGACGGG - Intronic
1051182520 9:14426260-14426282 GGTGGAAGGGCACAGAGTGCAGG - Intergenic
1053173649 9:35907674-35907696 GGTGCTGGGGTGCAGGGTGTTGG + Intergenic
1060798522 9:126528464-126528486 GGTGCCAGGGGCCAGGGTGCTGG - Intergenic
1061462526 9:130751700-130751722 GGTGTTGAGGAGCAGAGTGCAGG - Intronic
1061798540 9:133102201-133102223 AGTCCTTGGGCGCAGGGTGCAGG - Intronic
1062453865 9:136626703-136626725 GCTGCAAGGGCTGAGAGTGCAGG - Intergenic
1189972316 X:46430676-46430698 GGTACTAGGAAGCAGGGTGCTGG + Intergenic
1192656974 X:73002936-73002958 TGGGCTAGCGCGCAGGGTGCGGG - Intergenic
1192665146 X:73080065-73080087 TGGGCTAGCGCGCAGGGTGCGGG + Intergenic
1192965466 X:76172725-76172747 GGTGCTAGGGCGCAGAGTGCAGG - Intergenic
1194433757 X:93844411-93844433 GATGCTCAGGAGCAGAGTGCTGG - Intergenic