ID: 1192965754

View in Genome Browser
Species Human (GRCh38)
Location X:76174824-76174846
Sequence TACTACTGAATAGCAAATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 212}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192965754_1192965759 0 Left 1192965754 X:76174824-76174846 CCTTAATTTGCTATTCAGTAGTA 0: 1
1: 0
2: 0
3: 21
4: 212
Right 1192965759 X:76174847-76174869 GGATGGGGAGATTTATGACCTGG 0: 1
1: 0
2: 1
3: 15
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192965754 Original CRISPR TACTACTGAATAGCAAATTA AGG (reversed) Intronic
902245499 1:15118029-15118051 TACTACTGCACAGCACTTTATGG + Exonic
907664325 1:56420959-56420981 TAGTACTGAAAACCAAAATATGG + Intergenic
908266399 1:62383685-62383707 TACTACTGAGTGGCAAAGCAGGG - Intergenic
908433375 1:64080766-64080788 TCCTACTCAAAAGCAAATGAAGG - Intronic
910249676 1:85183153-85183175 TAGTACTGAATTGGGAATTATGG - Exonic
910482400 1:87672897-87672919 TTCTCCTTAATAGAAAATTAAGG + Intergenic
911426343 1:97718635-97718657 TTCTACTGATTAAAAAATTATGG - Intronic
911938600 1:104012686-104012708 TAATATTGGATAGCAAAATAGGG - Intergenic
912022249 1:105119963-105119985 AATCACTGAATAGCAAAATATGG - Intergenic
916964363 1:169919943-169919965 TACTAATGAAAACAAAATTAGGG + Intergenic
918061813 1:181068119-181068141 TACTACTTGATAGCACAATATGG - Intergenic
919041101 1:192389669-192389691 TATTAATCAATAGCAAATTGTGG - Intergenic
919953376 1:202387812-202387834 TAATTCTGAATAGCAGATTTGGG + Intronic
923377888 1:233383551-233383573 CACTTCTGAATATCAAATAAAGG - Exonic
923955732 1:239017199-239017221 TAGTACTTAATGTCAAATTATGG + Intergenic
924761597 1:246992479-246992501 TACTATTGAATAGCACAACAGGG + Intronic
1066072629 10:31835440-31835462 TAATAAGGACTAGCAAATTATGG + Intronic
1066508562 10:36070056-36070078 TTCTAATGAATAGAAAATTGTGG + Intergenic
1067245325 10:44536647-44536669 TACTGCTGAATAGGAGATTCTGG + Intergenic
1068003194 10:51360943-51360965 AACTAGTGAAGAGCAGATTATGG + Intronic
1068786342 10:60979504-60979526 TATTGCAGAATGGCAAATTATGG + Intronic
1071221357 10:83468878-83468900 TACTACTTGATAGCAAAATAGGG + Intergenic
1071589243 10:86856484-86856506 TTCCAGAGAATAGCAAATTAAGG + Intronic
1071706410 10:88004245-88004267 TAGAACTGAATAGGTAATTATGG + Intergenic
1074183338 10:111081823-111081845 TACTGATGAATAGCCACTTATGG + Intergenic
1074556278 10:114493621-114493643 TGCTAGTGAATAGGAAATAATGG - Intronic
1074720387 10:116259271-116259293 GACAAATGAATAGCACATTAGGG + Intronic
1074793654 10:116918776-116918798 TTCTACAGATTAGCAAATCAAGG + Intronic
1078501165 11:11879001-11879023 TATTTCTGAATAGCCCATTATGG + Intronic
1078901543 11:15647234-15647256 TACTTCAGAAAATCAAATTAAGG + Intergenic
1079073855 11:17371166-17371188 TTCTACTGGACAGCATATTATGG + Intronic
1079389512 11:20009270-20009292 CACAACTGAAAAGAAAATTAGGG - Intronic
1079390482 11:20018021-20018043 TAATACTGATTCCCAAATTAAGG + Intronic
1079588889 11:22158242-22158264 TCCTGCTGAATAGCAAAGAAAGG + Intergenic
1079931028 11:26560824-26560846 TACTACTAAAATACAAATTAAGG + Exonic
1080757723 11:35218206-35218228 TACTGCTAAAAAGCAAAATAAGG - Intronic
1083863606 11:65441016-65441038 CACTACTGAGTGGCAAAGTAGGG - Intergenic
1084171412 11:67402708-67402730 TGCTACTCAAAAGCTAATTATGG - Intronic
1091241386 11:134054749-134054771 TTCTACTCAATAGCAAAGTCTGG + Intergenic
1091661836 12:2390045-2390067 TACTACTGAATAGAAGTTGAGGG + Intronic
1093323562 12:17744217-17744239 TATTACTTAATAGGAAAGTATGG - Intergenic
1094824362 12:34257543-34257565 AAATATTGAAAAGCAAATTATGG - Intergenic
1095285573 12:40406557-40406579 TAATATTGTTTAGCAAATTAAGG - Intronic
1096825360 12:54272485-54272507 TACTACTGGAAAGAAAATTCAGG + Intronic
1098326870 12:69312349-69312371 TACTTCTGAATGGCTGATTATGG - Intergenic
1098849720 12:75581267-75581289 TAGTACTGAATATAAAATAATGG - Intergenic
1099288986 12:80751503-80751525 TACTACTTGATAGCACAATATGG + Intergenic
1099620774 12:85000483-85000505 TAATAGTGGATAGCAAATTAGGG - Intergenic
1099692277 12:85972164-85972186 TATGACTGATTACCAAATTATGG + Exonic
1099696156 12:86021920-86021942 TACTACCAAATAACAAATTTGGG + Intronic
1099810362 12:87573870-87573892 TACTATTTAATAGCACAGTAGGG - Intergenic
1100760028 12:97797135-97797157 TACTAATGAATAGCCAATATTGG - Intergenic
1100844856 12:98647293-98647315 TACTTCTGAGTAGCAAAATTTGG - Intronic
1100972581 12:100086858-100086880 TCTTACTGAAAAGGAAATTAAGG + Intronic
1101461102 12:104894844-104894866 TACTAGTAACTAACAAATTAAGG + Intronic
1103852842 12:123944434-123944456 TTCTCTGGAATAGCAAATTAGGG - Intronic
1105560172 13:21483174-21483196 TGCTCCTGAATAGCAATTTTTGG + Intergenic
1109383161 13:61591986-61592008 TTCTGATGAATAGCAAATTCAGG - Intergenic
1110403310 13:75119632-75119654 TACTACTGAATTAAAAATAAGGG + Intergenic
1110702002 13:78559865-78559887 GACAAATGAATAGAAAATTAAGG - Intergenic
1111711511 13:91820602-91820624 TTCTACTGATTAGCAAACTATGG - Intronic
1112080665 13:95966477-95966499 TACTATTCAATAGCAAAGTAGGG + Intronic
1115785039 14:36816117-36816139 TAATACTGAAAAGCAAAGCAAGG + Intronic
1116675062 14:47895711-47895733 GACTACTGATTTGAAAATTAAGG + Intergenic
1117054237 14:51895181-51895203 AACTACTAAATAGTTAATTAGGG + Intronic
1117482553 14:56162182-56162204 TACTATTTAATAGCACAATAAGG - Intronic
1118659053 14:67987249-67987271 TACTACTTGATAGCAAAATAGGG - Intronic
1120637267 14:86967648-86967670 TACTACTGTATTTCACATTAGGG - Intergenic
1124814632 15:32977067-32977089 TATTACTGGATATCAATTTAGGG - Intronic
1125069511 15:35535098-35535120 CACTACTCAATAGGAATTTAGGG + Intronic
1126304535 15:47240213-47240235 TACTACTGAATATAGAATTTAGG + Intronic
1127137246 15:55937091-55937113 TAGTGCTCAATAGCAAATTATGG - Intronic
1127422766 15:58823990-58824012 TACTACTGAATAGCATACTCTGG - Intronic
1127682023 15:61306755-61306777 TTCTACTGATGAGAAAATTAAGG - Intergenic
1128272905 15:66327234-66327256 TACTTCTGTATTACAAATTATGG - Intronic
1128863402 15:71093505-71093527 TATTACTGAATAGCAAAGGAAGG - Intergenic
1130220533 15:82015640-82015662 TGCTACTTAATAGCAGAATAAGG + Intergenic
1137899918 16:52256390-52256412 CACTACTGAAGGACAAATTATGG - Intergenic
1137907905 16:52343344-52343366 TATCACTGAATATCAAATTCTGG - Intergenic
1140108674 16:71984495-71984517 TACTTCTGAATAGAAAAGTTTGG - Intronic
1140130352 16:72155423-72155445 GAATACAGAATAGCACATTAAGG - Intronic
1140870952 16:79106035-79106057 TATTACTGAAAAGCATATAATGG - Intronic
1142627535 17:1202036-1202058 TGCTCTTGAATAGCAAAGTATGG - Intronic
1143362083 17:6380224-6380246 GACTAGTGAATAACAGATTATGG - Intergenic
1145180546 17:20746872-20746894 GGCTACTAAATAGTAAATTAGGG + Intergenic
1146512563 17:33462729-33462751 TCCTTCTGAATATCAAAGTAGGG - Intronic
1150565760 17:66338017-66338039 CACTACTCAATTGGAAATTAAGG - Intronic
1151919551 17:77143082-77143104 TACTACTGTATCTCAAACTATGG - Intronic
1153597296 18:6740808-6740830 TACAACTGGAAAGCAAAGTATGG + Intronic
1155392879 18:25354075-25354097 TAGTACTGCATAGCATTTTAAGG + Intergenic
1155866801 18:30975330-30975352 TATTACTGAGCAACAAATTATGG + Intergenic
1157639541 18:49199481-49199503 TAAGACTGAATACCACATTATGG + Intronic
1158380958 18:56929504-56929526 TTTTACTTAATAGCACATTACGG - Intronic
1166054479 19:40280223-40280245 TAATACTGAATAGCAACGCAGGG - Intronic
925500399 2:4497677-4497699 TACTGAAGAATAGCAATTTAGGG - Intergenic
926750238 2:16193132-16193154 TTCTACAGAATAGGAAATTGAGG - Intergenic
931363760 2:61600924-61600946 TTCTAATGAAAACCAAATTACGG - Intergenic
933115452 2:78463790-78463812 TTCTACTTAATAGCAGAATAAGG - Intergenic
935295857 2:101648995-101649017 GACTAATGAATAACAAATTATGG - Intergenic
936255918 2:110911383-110911405 TATTACTCAATACCAAAATAAGG + Intronic
936256156 2:110915064-110915086 TACTATTTAATAGCAAAACAGGG - Intronic
936892044 2:117382789-117382811 TAATACTCAATAGCATAGTAAGG - Intergenic
937469872 2:122165753-122165775 TATTACTGAATTGAAAATTAAGG - Intergenic
939800950 2:146707156-146707178 TACTACTTGATAGCACAATAGGG + Intergenic
940640420 2:156340333-156340355 TATTAGTGAATAGAAAATAAAGG + Intronic
941408985 2:165129077-165129099 TTCTCCAGAATAGTAAATTAGGG - Intronic
942511119 2:176702474-176702496 TAATAATAAATAGCAAATTTGGG - Intergenic
944198341 2:197079126-197079148 GATTACTGAATAGCAAGTTTTGG + Intronic
945817445 2:214623198-214623220 TTCTAAGGAATAGCAAATTTTGG - Intergenic
948349624 2:237328047-237328069 TAATAAAGAAGAGCAAATTAAGG - Intronic
1169133525 20:3181332-3181354 TACCTCTGAACAGCAAATTAGGG + Intergenic
1169997970 20:11579995-11580017 TGCTACTGAATAGAATAATATGG - Intergenic
1170919054 20:20658652-20658674 TACTACTGATCAGCACATCAGGG + Intronic
1173198467 20:40935813-40935835 TACTGCTGAATATTAAATTCAGG - Intergenic
1176946450 21:14988121-14988143 CACTACTGAATAGCAGAGTCAGG - Intronic
1177569420 21:22868849-22868871 TACTACTTTATAGCACAATAGGG - Intergenic
1182388798 22:29972239-29972261 TGCTAATGAATAACAAATGATGG + Intronic
1184939597 22:47752945-47752967 GACTTCTGAATAGCAAACCAAGG - Intergenic
949089886 3:14680-14702 TATTAATGAATACCTAATTAAGG - Intergenic
950000215 3:9650528-9650550 AACTACAGAATAGCAACTCACGG - Intronic
950985839 3:17365465-17365487 GACTACTGGATAAAAAATTAAGG - Intronic
952819368 3:37472774-37472796 TACTGGTGCATAACAAATTAAGG + Intronic
955481054 3:59390888-59390910 TACTATTTGATAGCAAAATAGGG - Intergenic
955620203 3:60855253-60855275 TACTACTGAATACCAATCAATGG - Intronic
955638079 3:61052133-61052155 TTCTACTTAAAAGCAAATCATGG + Intronic
957029562 3:75224407-75224429 TATTAATGAATAACTAATTAAGG - Intergenic
957112457 3:75981833-75981855 TACTACTTGATAGCACAATAGGG - Intronic
959763422 3:109996044-109996066 TACTATTCAATAGCACAGTAGGG - Intergenic
960313285 3:116143390-116143412 TACTACTTAATAGCACAACAGGG + Intronic
960505730 3:118491049-118491071 TACTACTTGATAGCACAATATGG + Intergenic
961178169 3:124853238-124853260 TACAACTGAACAGAAAATTAAGG + Intronic
965594271 3:170393424-170393446 TACTACTTAATATCAAAATCAGG + Exonic
965861120 3:173151715-173151737 TACTATTTAATAGCACAATAGGG + Intergenic
966312387 3:178608591-178608613 TACTATTCAATAGCACAATAGGG - Intronic
969919667 4:10525474-10525496 TACTTCTGAACAGCAATTTATGG - Intronic
970675254 4:18441623-18441645 TAGCAGTAAATAGCAAATTAAGG - Intergenic
970855143 4:20642608-20642630 TACAACTGAAAAGAAAATTTAGG + Intergenic
971375506 4:26052767-26052789 TTCTACTGATGAGGAAATTAAGG - Intergenic
971826277 4:31627512-31627534 TGCCACTGAATAGCAAACTTGGG - Intergenic
973088942 4:46107123-46107145 TACTACTTCATAGCACAATAGGG - Intronic
976789538 4:88862488-88862510 GCCTACTGAATAGCAAATAAAGG - Intronic
977137933 4:93329596-93329618 TATTACTGAATATCAAAGGATGG + Intronic
978987764 4:115035539-115035561 GAGTAATGAATAGCAAATTGTGG + Intronic
980317737 4:131225008-131225030 TACTAGTGAATTGCAATGTATGG + Intergenic
980447748 4:132932892-132932914 TACTACTTAATAGCACAATAGGG + Intergenic
980674738 4:136062143-136062165 TTCAAGTGAATAGAAAATTAAGG + Intergenic
980743174 4:136978059-136978081 TACCATTAAATAGCATATTAGGG + Intergenic
983476762 4:168221379-168221401 TAAAACTGAATAACAAATAATGG - Intronic
984130445 4:175868568-175868590 TATTTTTGAATAACAAATTAAGG - Intronic
987806977 5:22781768-22781790 TACTATTGAATAGCAGACAAGGG + Intronic
990547122 5:56834122-56834144 TACTACTGAAGAAAAAATAATGG - Intronic
991220129 5:64204758-64204780 TTCTACTGAATACCAAAGTTAGG + Intronic
991369256 5:65901161-65901183 TACAACTGAATATGAAATTGGGG + Intergenic
992229112 5:74646070-74646092 TACTACAGATTAGGAAATGAAGG - Intronic
993152679 5:84180943-84180965 TAATATTGAATAGCAATTTCTGG + Intronic
994372417 5:98982441-98982463 TATCACTGAATAGAAAATGATGG + Intergenic
994695571 5:103069383-103069405 CACTAGTGAATGGCAACTTAGGG - Intergenic
1000537139 5:162493208-162493230 TTCTACAGAATAGGAAATTAAGG - Intergenic
1005680877 6:28207252-28207274 TACAACTGAGTGGAAAATTATGG + Intergenic
1007013301 6:38438271-38438293 TACTACTGGATTGCAGCTTATGG + Intronic
1007151755 6:39700213-39700235 TACTATTGAATAGCACAACAGGG - Intronic
1008243347 6:49140752-49140774 TACTTCTGAATATTATATTATGG - Intergenic
1009528584 6:64780357-64780379 TACTACTGAAGAAAGAATTATGG + Intronic
1010100018 6:72092966-72092988 TAGCATTGAATAGCAAATCAGGG - Intronic
1010588481 6:77684409-77684431 TACTATTCAATAGCACAATAGGG - Intergenic
1013151929 6:107454609-107454631 GATCAGTGAATAGCAAATTATGG + Intronic
1014951903 6:127566216-127566238 TGCCACTGAAAAGCAAATCAAGG + Intronic
1017264621 6:152428154-152428176 CACTACTAAATAGGAAATTCTGG - Intronic
1019634734 7:2069477-2069499 CACTGCTGAATAGCTACTTAAGG + Intronic
1020033310 7:4948138-4948160 TACAACTGAATAGGAGATTGGGG + Intronic
1021350216 7:19583819-19583841 TACTATTCAATAGCACAATAGGG + Intergenic
1021417124 7:20400247-20400269 TACTACTCAATTGAAAATGAAGG - Intronic
1022061774 7:26804039-26804061 TACTATTGAATAGCACAATAGGG + Intronic
1022073669 7:26943863-26943885 TAATACTGAAAAACAAATTTGGG - Intronic
1024404743 7:48965127-48965149 TATTAGTCAATAGCAAATCATGG + Intergenic
1024731522 7:52258751-52258773 TACTAATGACTAGAAAAGTAAGG + Intergenic
1028990965 7:97048512-97048534 TACTATTTAATAGCACATCAGGG - Intergenic
1029577024 7:101410315-101410337 TATTACAGAAGAGCAAACTAGGG + Intronic
1031272058 7:119663973-119663995 TACTATTTAATAGCACAATATGG + Intergenic
1034116763 7:148590510-148590532 TACTACTGAAAAAGTAATTAAGG - Intergenic
1038594658 8:28876465-28876487 TACTAATGACTAGAAAATTAAGG + Intronic
1039219206 8:35309793-35309815 AACTAGTGAATAGCAATTTCTGG - Intronic
1040699832 8:50048695-50048717 TAATACTAATTAGTAAATTATGG + Intronic
1041440833 8:57895067-57895089 TACTACTGATTGACAAATGAAGG + Intergenic
1041813810 8:61943321-61943343 TTCTAATAAATAGCATATTATGG - Intergenic
1042166834 8:65954006-65954028 TACTACAGATTATCAAATCAAGG + Intergenic
1042369866 8:67979229-67979251 TACAACTGAAAAGCATCTTAGGG + Intronic
1042667185 8:71220155-71220177 CTCTACTGAACACCAAATTAGGG - Intronic
1046141200 8:110095042-110095064 AAGTACTGAATTTCAAATTAGGG + Intergenic
1048549309 8:135419144-135419166 TACTACTTAATAGCACAACAGGG + Intergenic
1048708339 8:137180029-137180051 TACAGCTGAACAGCAAATAAGGG + Intergenic
1048711881 8:137221658-137221680 TACTTCTTAATAGCACAATAGGG - Intergenic
1050821957 9:9890159-9890181 TACTCCTCACTAGTAAATTAAGG + Intronic
1050970775 9:11870256-11870278 CACTACTCAATAGCAAATCTCGG - Intergenic
1052331225 9:27270623-27270645 TACAACTGAATAACACTTTACGG - Intergenic
1052602524 9:30653828-30653850 TACTACAGAATAGCTATTAAAGG + Intergenic
1053319759 9:37085964-37085986 TACTACTGAATAAAAAGTTATGG - Intergenic
1054756144 9:68960224-68960246 AACTTCTGAACAGCAACTTAGGG - Intronic
1057028185 9:91752379-91752401 TATTGCTGAATAGCATTTTATGG - Intronic
1057762355 9:97887034-97887056 TACTATTTGATAGCAAAATAGGG - Intergenic
1058157563 9:101532552-101532574 AACTACTGAATGGCAAGTAATGG - Intronic
1058302098 9:103388716-103388738 TATTACTGAATATGGAATTATGG + Intergenic
1058406927 9:104687241-104687263 TACTATTGGATATAAAATTATGG + Intergenic
1058471505 9:105283989-105284011 TACTGCTGAATAGACAATTCAGG - Intronic
1059074910 9:111182424-111182446 TACTATTCAATAGCACAATATGG + Intergenic
1060313844 9:122489779-122489801 TACAACTGAGTATCAAATTGAGG - Intergenic
1060378813 9:123144782-123144804 TACCTCAAAATAGCAAATTATGG + Intronic
1186035121 X:5414069-5414091 TAATATTGTATAGCACATTAAGG + Intergenic
1187192694 X:17050915-17050937 TACTACTTGATAGCACAATAGGG - Intronic
1187194601 X:17071066-17071088 TGCTACAAAATAGAAAATTAAGG + Intronic
1188445457 X:30249453-30249475 TACTTCTGAAGAGGAATTTAGGG - Intronic
1188724410 X:33564060-33564082 TACTATTTGATAGCAAAATAGGG - Intergenic
1189977414 X:46476342-46476364 TAAAACTGAATAGAAAAATAAGG - Intronic
1190580400 X:51888092-51888114 TACTACTTGATAGCACAATAGGG + Intronic
1190688421 X:52894191-52894213 TTTTACTGAATAGCACATGATGG - Intronic
1190697562 X:52961601-52961623 TTTTACTGAATAGCACATGATGG + Intronic
1192965754 X:76174824-76174846 TACTACTGAATAGCAAATTAAGG - Intronic
1193106869 X:77686125-77686147 TACTATTTAATAGCACAATAGGG + Intronic
1193541615 X:82779721-82779743 TACTATTTGATAGCAAAATAGGG + Intergenic
1193579194 X:83241934-83241956 TACTATTTGATAGCAAAATAGGG + Intergenic
1196361513 X:114866561-114866583 TACTATTGGATAGCACAATAGGG - Intronic
1196389593 X:115193279-115193301 TACCGATGAATTGCAAATTAAGG + Intronic
1196413756 X:115448638-115448660 TACTGCTGAGTAGAAAAGTAGGG + Intergenic
1197261376 X:124322396-124322418 TATTACTGAAAATCAAATTATGG - Intronic
1198147697 X:133873952-133873974 TACTCCTGAAGAGCAGAATATGG - Intronic
1198412778 X:136388489-136388511 TACTACAGAGAAGGAAATTAAGG - Intronic
1199779669 X:151046618-151046640 TGCTACTGCATTGCAAATTTGGG + Intergenic
1200949722 Y:8884223-8884245 TACTACAGAGTAGCAAATCAGGG - Intergenic
1201564982 Y:15356104-15356126 TGATATTGAATAGAAAATTAGGG + Intergenic
1202163904 Y:21966742-21966764 TACTGCAGAGTAGCAAATCAGGG + Intergenic
1202227452 Y:22619622-22619644 TACTGCAGAGTAGCAAATCAGGG - Intergenic
1202315673 Y:23576032-23576054 TACTGCAGAGTAGCAAATCAGGG + Intergenic
1202555095 Y:26094042-26094064 TACTGCAGAGTAGCAAATCAGGG - Intergenic
1202581288 Y:26383466-26383488 TAATTCTGAATAGCAGATTTGGG - Intergenic