ID: 1192965846

View in Genome Browser
Species Human (GRCh38)
Location X:76175899-76175921
Sequence CAGAAGGCTTGGATGGGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 516}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192965837_1192965846 20 Left 1192965837 X:76175856-76175878 CCCTTTCAGAGGAGGATGGATCA 0: 1
1: 0
2: 1
3: 17
4: 178
Right 1192965846 X:76175899-76175921 CAGAAGGCTTGGATGGGGAGTGG 0: 1
1: 0
2: 1
3: 41
4: 516
1192965838_1192965846 19 Left 1192965838 X:76175857-76175879 CCTTTCAGAGGAGGATGGATCAG 0: 1
1: 0
2: 0
3: 15
4: 204
Right 1192965846 X:76175899-76175921 CAGAAGGCTTGGATGGGGAGTGG 0: 1
1: 0
2: 1
3: 41
4: 516
1192965835_1192965846 27 Left 1192965835 X:76175849-76175871 CCATCAGCCCTTTCAGAGGAGGA 0: 1
1: 0
2: 1
3: 20
4: 200
Right 1192965846 X:76175899-76175921 CAGAAGGCTTGGATGGGGAGTGG 0: 1
1: 0
2: 1
3: 41
4: 516
1192965833_1192965846 28 Left 1192965833 X:76175848-76175870 CCCATCAGCCCTTTCAGAGGAGG 0: 1
1: 1
2: 1
3: 10
4: 130
Right 1192965846 X:76175899-76175921 CAGAAGGCTTGGATGGGGAGTGG 0: 1
1: 0
2: 1
3: 41
4: 516

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192965846 Original CRISPR CAGAAGGCTTGGATGGGGAG TGG Intronic
900559343 1:3295981-3296003 CAGAAGGCCTGGGTGGGGCTGGG + Intronic
900851090 1:5143657-5143679 CAGAAGGCGTGGAGGGACAGCGG + Intergenic
901280072 1:8026744-8026766 AAGAAGCCCTGGAGGGGGAGAGG + Intergenic
901592316 1:10355486-10355508 CAGTAGGTTTACATGGGGAGGGG - Intronic
901658821 1:10786174-10786196 CAGAAGGCCAGGGTGGGGTGGGG - Intronic
901849808 1:12008313-12008335 CAGAAGGGGTGGTTGGGCAGAGG + Intronic
901918670 1:12520034-12520056 AAGGAGGCTTGGATGAGGATGGG + Intergenic
902191639 1:14767310-14767332 CTGAAGGCTGGGAGTGGGAGGGG + Intronic
902771926 1:18650107-18650129 GAGTAGCCTTGGATGGGAAGTGG - Intronic
903085219 1:20851298-20851320 CAGGAGGTGTGGATGTGGAGAGG - Exonic
903323585 1:22556614-22556636 CAGAAAGCTTGGGGAGGGAGAGG + Intergenic
903584468 1:24400835-24400857 CAGGAGGCTGGGTTGGGGTGGGG - Intronic
904029919 1:27527696-27527718 CCCCAGGCTTGGCTGGGGAGGGG - Intergenic
904266610 1:29321970-29321992 CAGAAAGCTGGGGTGGGAAGGGG - Intronic
904916968 1:33977210-33977232 CAGCAGGGCTGGGTGGGGAGTGG + Intronic
905776012 1:40667582-40667604 CAGAAGGACTGGATGGGAGGTGG + Intergenic
906214949 1:44033235-44033257 CAGTAGGCTGGGGTGGGGACAGG + Intergenic
906216529 1:44044133-44044155 CAGAAGGCATACATGGAGAGAGG - Intergenic
906440834 1:45842473-45842495 CAGATTGCATGGAAGGGGAGTGG - Intronic
906695116 1:47818279-47818301 CAGATGGCCAGGATGGGGAGTGG + Intronic
907340545 1:53732312-53732334 CCGAAGGCTGGGCTGGGTAGGGG - Intronic
907961554 1:59288186-59288208 CAGAAGGACTGAATGGTGAGGGG - Intergenic
908356557 1:63329080-63329102 CAGAGGGCAAGGAGGGGGAGTGG - Intergenic
911402774 1:97397524-97397546 CAGGAGGGTTGGGTGGGGTGAGG - Intronic
912431346 1:109630045-109630067 CTGAAGGCTGGGGTGGGGAAGGG - Intronic
912728223 1:112077807-112077829 CAGCAGGCTTGCATTGAGAGTGG + Intergenic
913191367 1:116416016-116416038 CAGAAGGGTTGGGGGGGGGGAGG + Intergenic
915528983 1:156492686-156492708 CAGAAGCCCTGGCTGAGGAGAGG + Intronic
917416746 1:174818541-174818563 AAGAAGGTTAGTATGGGGAGAGG + Intronic
917737341 1:177932936-177932958 CAGAAGAGTGGGATGAGGAGGGG - Intronic
917915037 1:179693503-179693525 CAAAAGCCTGGGGTGGGGAGTGG + Intergenic
918177772 1:182060486-182060508 CAGAAGCCATGGATGGAGGGAGG + Intronic
918250329 1:182697770-182697792 CAGGAGGATTGGCTGGGGTGAGG - Intergenic
918327678 1:183425905-183425927 CACTAGGCTTGAAGGGGGAGGGG + Intergenic
918498406 1:185165708-185165730 CAGGGGGATGGGATGGGGAGAGG - Intronic
919607323 1:199700760-199700782 CAAAAAGGTTGGATGTGGAGAGG + Intergenic
920819759 1:209369386-209369408 CAGGAGGGTGGGATGGGAAGGGG + Intergenic
921090462 1:211837002-211837024 CAGAAGGCTTGGATAAGAGGGGG - Intergenic
922233728 1:223707676-223707698 TAGAAGGCTGGCAAGGGGAGTGG + Intronic
922352814 1:224748126-224748148 CAGAAGCCTGGGAATGGGAGTGG + Intergenic
922661923 1:227437606-227437628 AAGAATGCTTGGATGGGTTGGGG - Intergenic
922705476 1:227788203-227788225 CAGAAGGCGTGGGATGGGAGGGG + Intergenic
922856432 1:228778928-228778950 CAGAAGGCAGGGGTGGGCAGTGG - Intergenic
923093100 1:230754126-230754148 CAGGAGGCTGGGAAGGGGCGGGG + Intronic
923258401 1:232242684-232242706 CCAAAGGCTTGGAAGGGTAGTGG + Intergenic
923494379 1:234511709-234511731 AAGAAGGGTTGGTTGGGGACTGG - Intergenic
923537384 1:234863512-234863534 CAGAGGGGTTGGAAGGGGACAGG - Intergenic
923547553 1:234933803-234933825 CAGGAGGCTGGGATGGGAATTGG + Intergenic
923781863 1:237032002-237032024 CAGAAGCCGGGGCTGGGGAGAGG - Intergenic
923995662 1:239491346-239491368 CTGAAGGCTGGGAGGGGTAGTGG - Intronic
924741012 1:246794166-246794188 CAGGAGGGTGGGGTGGGGAGAGG + Intergenic
1063230682 10:4063180-4063202 AAGAAGTCTTGGATGGGATGGGG + Intergenic
1063728270 10:8664913-8664935 CACAAGTCTTGGAGAGGGAGAGG + Intergenic
1064950503 10:20843948-20843970 CAGGAGGAGAGGATGGGGAGAGG - Intronic
1067250828 10:44585985-44586007 CAGAAGTCTAGGATGGTGACAGG - Intergenic
1067296379 10:44977369-44977391 CAGAAGCCTTTACTGGGGAGGGG + Exonic
1067391144 10:45865352-45865374 CAGAAGGGGTGGCTGGGCAGAGG + Intergenic
1067714376 10:48678030-48678052 CAGCAGGCTTGGAAAGGGAAGGG - Intergenic
1068700652 10:60016156-60016178 TAGAAGACTTGAATGTGGAGAGG + Intergenic
1070407932 10:76113080-76113102 CAGAAGGCATCAGTGGGGAGAGG + Intronic
1070703385 10:78619385-78619407 TTCAAGGCTTGGGTGGGGAGGGG + Intergenic
1070747632 10:78944268-78944290 CAGAGGGCAGGGATGGGCAGAGG + Intergenic
1071316542 10:84406249-84406271 CAGAAGGTATGGATGGGAGGAGG + Intronic
1071725487 10:88194195-88194217 GAGAAGGCTTTGTTGTGGAGGGG + Intergenic
1072398767 10:95074305-95074327 CAAAAGGCTGGGAAGGGTAGTGG - Intergenic
1072794139 10:98341483-98341505 CAGAAGGGTGGGATGGTGGGAGG - Intergenic
1073178477 10:101570321-101570343 CGGAAGGCCTGGGTGGGGTGTGG - Intergenic
1073218904 10:101853342-101853364 CTGAAGTCTTGGATGGGTTGGGG - Intronic
1073447264 10:103589176-103589198 CAGAAAGCATACATGGGGAGGGG + Intronic
1073724193 10:106210781-106210803 CTGAGGGCTTGGATGGTGTGGGG - Intergenic
1074411677 10:113234124-113234146 TTGAAGGCTTGAGTGGGGAGTGG + Intergenic
1075013865 10:118895854-118895876 CAGAAGGGGTGGCTGGGCAGAGG - Intergenic
1075208957 10:120475012-120475034 CACCAGATTTGGATGGGGAGGGG + Intronic
1075685807 10:124364481-124364503 AGGCATGCTTGGATGGGGAGGGG + Intergenic
1076405818 10:130212042-130212064 CAGCAGCCTTGGAGGAGGAGCGG - Intergenic
1076629422 10:131843235-131843257 CAGAGGGCTTGAGTGGGGACAGG + Intergenic
1077554098 11:3217756-3217778 CAGCAGGCCTGGCTGGGGGGTGG + Intergenic
1078013194 11:7589815-7589837 TAGAAGGCTTGGATGGATAGTGG - Intronic
1079096420 11:17513338-17513360 CAGAAGGCTTGTTGGGGGCGGGG - Intronic
1079150647 11:17896528-17896550 CAGAAGACTTGGAAGGGGAAGGG + Intronic
1080210544 11:29780534-29780556 CAAAAGGTGGGGATGGGGAGTGG + Intergenic
1080990739 11:37531143-37531165 CTGAAAGCTTGGGAGGGGAGAGG - Intergenic
1081713764 11:45234286-45234308 CAGAAGGCTGGTCTGGAGAGAGG - Intronic
1081754081 11:45532305-45532327 CTGATGGCTGGGATGGGGTGAGG - Intergenic
1081770712 11:45649208-45649230 CAGGAGGCAGGGATGGGGAAAGG + Exonic
1081964957 11:47163973-47163995 CAGTAGGCTTGACTGGGGATGGG - Intronic
1082774556 11:57235431-57235453 CAGAAGGCAGGGATAAGGAGCGG + Exonic
1082811765 11:57482826-57482848 CAGATGGCTGGGGAGGGGAGAGG - Intergenic
1083180357 11:60981387-60981409 CAGGAGTCTTGAGTGGGGAGGGG - Intronic
1083448140 11:62724374-62724396 CAGCAGGCTCAGATGGTGAGCGG - Exonic
1083779701 11:64911396-64911418 CAGAAGGCTTGGTCAGGCAGGGG + Intronic
1084169238 11:67392504-67392526 CTGAAGGCTTCCATGGGGAAAGG + Intronic
1084382133 11:68819399-68819421 GCGAAGGCTTTGATGGGGAAGGG - Intronic
1084683349 11:70679776-70679798 CAGAGGGCCTGGCTGGGGTGTGG - Intronic
1084732587 11:71082941-71082963 CAGAAGGGTTGGGGGGGGGGCGG - Intronic
1085199837 11:74695207-74695229 GATCAGGCTTGGGTGGGGAGGGG + Intergenic
1087333916 11:96818635-96818657 CAGAAGGAGAGGATGTGGAGAGG + Intergenic
1088781326 11:113136748-113136770 CAGGAGGCTGGGCTGTGGAGAGG + Intronic
1088821089 11:113457961-113457983 CAGCAGCCTGGGCTGGGGAGGGG + Intronic
1088916935 11:114234727-114234749 GAGAAGGCTGGGGTGGGGTGAGG - Intronic
1089032806 11:115350398-115350420 AAGAAGGCAGGGAAGGGGAGAGG + Intronic
1089309123 11:117546259-117546281 CAGAAGGCTTGGATTGGACTTGG + Intronic
1090297981 11:125607093-125607115 CAGAATGCTTGTATGGGTACTGG - Intronic
1090798843 11:130158439-130158461 CAGAACGCCTGGCTGGAGAGAGG + Intergenic
1090881045 11:130831543-130831565 CAGCAGGCGTGCAGGGGGAGGGG + Intergenic
1090941469 11:131391675-131391697 AAGAAGGCTAGGATTGGGTGCGG + Intronic
1091345052 11:134846856-134846878 CAGGTGGCTTGGATGGGGGTGGG + Intergenic
1091407908 12:220516-220538 GGGGAGGCTAGGATGGGGAGGGG + Intergenic
1092763816 12:11834382-11834404 CAGAAAGTTTGGATAAGGAGTGG + Intronic
1093043565 12:14414622-14414644 CACAAGGCCTAGATGGGGTGAGG + Intronic
1093378038 12:18455334-18455356 CAGGAGGTTGGGAAGGGGAGGGG + Intronic
1094352673 12:29544352-29544374 GAGAAGGGTAGGATGGGGGGTGG - Intronic
1094359035 12:29610003-29610025 CAGATGGCTTGAAGGGGCAGAGG - Intronic
1095388641 12:41678972-41678994 CTGAAGACTTTGATAGGGAGGGG + Intergenic
1095987997 12:48012623-48012645 CGGAAGGCTTGGATAGGTATTGG + Intergenic
1096196075 12:49649602-49649624 CAGAAGGACTGGAAGGGCAGGGG + Intronic
1096320933 12:50612155-50612177 CAGAAGGCTGAGATGGGAATGGG + Intronic
1096607617 12:52777837-52777859 CAGAGGGCCTGGAGTGGGAGCGG + Intergenic
1096657985 12:53103615-53103637 CAGAAGGGCTGGGAGGGGAGCGG + Exonic
1097221065 12:57451431-57451453 AGGAAGGCCTGGATGAGGAGAGG + Intergenic
1098908853 12:76188905-76188927 CAGAAGGGTAGGCAGGGGAGAGG - Intergenic
1099504686 12:83458946-83458968 CAAAATCCTTGGAAGGGGAGGGG + Intergenic
1099740382 12:86627150-86627172 CAGCAAGCCTGGCTGGGGAGGGG + Intronic
1101700738 12:107171498-107171520 CAGAAGGAGTGGATGGGGGATGG - Intergenic
1101876034 12:108597411-108597433 CTGGAGGTCTGGATGGGGAGGGG + Intronic
1102955875 12:117058767-117058789 AAAAAAGCTTGGCTGGGGAGAGG + Intronic
1103285013 12:119793603-119793625 CAGAAGGCATGTTTGGGTAGGGG - Intronic
1103302277 12:119937214-119937236 ATGTAGGCTAGGATGGGGAGGGG - Intergenic
1103364353 12:120370578-120370600 CCTAAGGCTTGGATATGGAGAGG - Intergenic
1103408047 12:120689468-120689490 ATTAAGGCATGGATGGGGAGTGG + Intronic
1103742056 12:123097559-123097581 GTGATGGCATGGATGGGGAGGGG + Intronic
1104175368 12:126326371-126326393 CAGCAAGCCTGGCTGGGGAGGGG - Intergenic
1104523340 12:129495720-129495742 CCGAAGGCTTTGACGGGGTGGGG + Intronic
1104672387 12:130689626-130689648 CCCAAGGCTTAGCTGGGGAGGGG + Intronic
1104723113 12:131057320-131057342 GAGAATGCTTGGAAGGGGAACGG + Intronic
1105846513 13:24298674-24298696 CAGTGGGCAAGGATGGGGAGGGG - Intronic
1106028900 13:25980441-25980463 AAGAAGGCCTGTAGGGGGAGTGG + Intronic
1106761997 13:32876465-32876487 CAGATGACTTGCATGGGGATAGG - Intergenic
1107451921 13:40517459-40517481 CAGACGGCTTGGCAGGTGAGGGG + Intergenic
1107579438 13:41766638-41766660 CAGAAGGCTAGGTGGGGGAGTGG - Intronic
1109311487 13:60699669-60699691 CAGAAGCCTGCAATGGGGAGTGG + Intergenic
1113301279 13:109022002-109022024 CAGAAGGCTGGGGTGGTGAGTGG + Intronic
1114453232 14:22839679-22839701 CAGTAGTCTTGCATGGGGACTGG - Intronic
1115188551 14:30721057-30721079 CAGTAGACATGGATGAGGAGAGG - Intronic
1115546471 14:34468899-34468921 AAGCAGGCATGAATGGGGAGAGG - Intergenic
1116510891 14:45745289-45745311 CATAATGCTTGGTTGGGGAGTGG + Intergenic
1118647189 14:67851479-67851501 CAGCAGTCCTGGTTGGGGAGTGG + Intronic
1118709847 14:68510156-68510178 AAAAAGCCCTGGATGGGGAGTGG - Intronic
1118765028 14:68903948-68903970 CAGGATGCCTGGATGGGGACAGG - Intronic
1119372235 14:74156802-74156824 CTGGAGGCTAGGAAGGGGAGGGG - Intronic
1120379181 14:83751727-83751749 AAGAAGGCTTAGCTGGGTAGAGG + Intergenic
1120682359 14:87495588-87495610 CAGGAGGCTGAGATGGTGAGAGG - Intergenic
1121026267 14:90618643-90618665 CAGAAGGTCTGGATGGAGGGTGG - Intronic
1121262455 14:92576273-92576295 CCGAAGGCAAGCATGGGGAGCGG - Intronic
1121283292 14:92714835-92714857 CAGGAGGCCTGGAGGGGGGGAGG - Intronic
1122293811 14:100693914-100693936 CAGAAGGGGTGGACGGGGCGTGG - Intergenic
1122388504 14:101364831-101364853 TACAAGGGTTGGAAGGGGAGAGG + Intergenic
1122585994 14:102807043-102807065 CAGAAGGCTTGCCTGGGCTGGGG - Intronic
1122639028 14:103146437-103146459 CTGGAGGCATGGATGGGGAAGGG + Intergenic
1122799018 14:104220685-104220707 GAGAGGGCTTGGAGGGGGATGGG + Intergenic
1122893748 14:104745097-104745119 CAGGAGGCCTGGCTGGGCAGGGG + Intronic
1202836008 14_GL000009v2_random:77546-77568 CAGCAGGATGGGATGGGCAGGGG + Intergenic
1124632920 15:31347471-31347493 CAGGGGGCTGGGCTGGGGAGGGG + Intronic
1124896856 15:33785523-33785545 CAGTGAGCTTGGATGTGGAGTGG - Intronic
1126209651 15:46086217-46086239 CATAAGGCTGGGAAGGGTAGCGG + Intergenic
1126732730 15:51700836-51700858 CAGAAAGCTGGGGTGGGGTGGGG + Intronic
1127382917 15:58445085-58445107 TAGCAGGGTGGGATGGGGAGTGG + Intronic
1127626924 15:60788756-60788778 CAGCAGGTTTGGATGGGCCGTGG - Intronic
1127729506 15:61786216-61786238 CTGGAGGCTTGGAAAGGGAGGGG - Intergenic
1128516242 15:68343855-68343877 CAGGAGGCTTAAATGGGGTGTGG + Intronic
1128730161 15:70015452-70015474 CATGAGGCCTGGGTGGGGAGGGG + Intergenic
1129120510 15:73393657-73393679 CAGAAGGCTGGGAGAGGAAGGGG + Intergenic
1129385906 15:75196001-75196023 GAGAGGCCCTGGATGGGGAGAGG + Intronic
1130191343 15:81738942-81738964 CAACAGGCTCGGATGGGCAGAGG - Intergenic
1130272143 15:82457553-82457575 CAAAGGGCTTTGTTGGGGAGAGG + Intergenic
1130530892 15:84747714-84747736 CAGAAGGCTGGGAGGGTGACCGG - Intergenic
1131282192 15:91031095-91031117 GAGAAGGCAAGGGTGGGGAGGGG - Intergenic
1131661884 15:94526093-94526115 GAGAGGGCTGAGATGGGGAGAGG - Intergenic
1131672098 15:94630974-94630996 CAGCAGGCAAGGTTGGGGAGTGG + Intergenic
1131746485 15:95453969-95453991 CAGAAGGCTGGGTTGGGGGTTGG + Intergenic
1132634323 16:936071-936093 AAGAAGGCTGGGAGGGAGAGAGG + Intronic
1133132373 16:3685201-3685223 CATAAGGATTGGGTGGGGAGTGG - Intronic
1133340244 16:5031264-5031286 CAGAATACTGGGATGGGGACAGG - Intronic
1133711581 16:8406693-8406715 GAGTAGGCATGGTTGGGGAGGGG - Intergenic
1133744379 16:8675506-8675528 GAGAAGGATGGGATTGGGAGCGG - Intronic
1134006627 16:10822418-10822440 CTGCAGGCTTTGTTGGGGAGGGG + Intergenic
1134222636 16:12367043-12367065 CACAAGGCTTGGATGATGAAGGG - Intronic
1134517594 16:14899515-14899537 CAGAAGGCTTGACCGGGGCGGGG - Intronic
1134705262 16:16298166-16298188 CAGAAGGCTTGACCGGGGCGGGG - Intergenic
1134870393 16:17647593-17647615 CAAAAGGCAGGGATGGGGAGAGG - Intergenic
1134962279 16:18413948-18413970 CAGAAGGCTTGACCGGGGCGGGG + Intergenic
1134966576 16:18496547-18496569 CAGAAGGCTTGACCGGGGCGGGG + Intronic
1135661149 16:24297715-24297737 CATAAGGGATGGATGGGGAGGGG + Intronic
1136054583 16:27678912-27678934 GAGAAGGACTTGATGGGGAGAGG + Intronic
1136088555 16:27902633-27902655 CAGCAGGGAGGGATGGGGAGGGG + Intronic
1136412404 16:30085074-30085096 CAGAAGGGTTGGAGGGGGCAGGG - Exonic
1136567068 16:31076916-31076938 CTGCTGGCTGGGATGGGGAGAGG - Exonic
1138226327 16:55298531-55298553 CTGAAGGCTTAGATTGGGACTGG - Intergenic
1139217674 16:65144738-65144760 CAGAAGGCCAGGAAAGGGAGGGG + Intergenic
1139527417 16:67525457-67525479 CAGAAAGCTGGGATGGGGGTGGG + Intronic
1139925341 16:70482929-70482951 GAGAAGGAAGGGATGGGGAGAGG - Intronic
1139925450 16:70483253-70483275 GAGAAGGAAGGGATGGGGAGAGG - Intronic
1140037276 16:71380954-71380976 CACAAGTGCTGGATGGGGAGAGG + Intronic
1140498979 16:75416279-75416301 CAGAAAGAGGGGATGGGGAGGGG + Intronic
1140731894 16:77863946-77863968 CAGAGGGGATGGATGGGTAGAGG + Intronic
1140775207 16:78243051-78243073 GAGGAGGCTAGGATGGGGAGAGG - Intronic
1140860449 16:79013310-79013332 CAGCAGGCTGTGCTGGGGAGTGG + Intronic
1140900568 16:79363526-79363548 CAGAATGGTTGGATGGGCACTGG + Intergenic
1141091471 16:81133254-81133276 CAGAAGCCTGGGGTGGGGACAGG + Intergenic
1141848798 16:86630020-86630042 CAGAAGGGGTTGTTGGGGAGAGG + Intergenic
1142005749 16:87688952-87688974 CCGGAGGCCTGGATAGGGAGGGG - Intronic
1142137745 16:88459510-88459532 GAGAAGGGTAGGAGGGGGAGAGG - Intronic
1142242606 16:88954428-88954450 CAGGAGCCTTGGATGGGGTCAGG - Intronic
1142242750 16:88954922-88954944 CAGGAGCCTTGGATGGGGTCAGG - Intronic
1142242852 16:88955264-88955286 CAGGAGCCTTGGATGGGGTCAGG - Intronic
1142517577 17:442827-442849 CAGCAGTCTGGGATAGGGAGGGG - Exonic
1142610635 17:1107817-1107839 CTGCAGGCCTGGGTGGGGAGTGG - Intronic
1142803968 17:2362036-2362058 CAGAATGCTGGCATTGGGAGTGG - Intronic
1143188534 17:5024602-5024624 CAGGAGGCCTGGAAGGGGAGGGG - Exonic
1143314739 17:6023754-6023776 CGGAAGGCATGGAGGGGAAGAGG + Intronic
1143776649 17:9203922-9203944 AGGAAGCCTTGGAAGGGGAGGGG + Intronic
1143941921 17:10551354-10551376 CAGAATGGCTGGATGGGGAGGGG - Intergenic
1144659628 17:17059783-17059805 CAGAATGTGGGGATGGGGAGTGG + Intronic
1145017984 17:19411387-19411409 TGGGAGGCTGGGATGGGGAGAGG - Exonic
1145097047 17:20039120-20039142 CCGAAGGCTTGGATGGACAGTGG - Intronic
1146031408 17:29369192-29369214 TAGAGGGCTTGGATGGGGGAGGG + Intergenic
1146173826 17:30652107-30652129 GAGAAGGCTTCCCTGGGGAGGGG - Intergenic
1146347282 17:32068128-32068150 GAGAAGGCTTCCCTGGGGAGGGG - Intergenic
1146975704 17:37109767-37109789 CAGAAGGACTGGATGGTGAGGGG - Intronic
1147256739 17:39186184-39186206 CAGAACGCAGGGATGGGGATGGG + Intronic
1147306266 17:39566593-39566615 CAGAAGGCTCGGGTTGGAAGAGG - Intergenic
1147807329 17:43141128-43141150 CAGTAGCCTGGGAGGGGGAGGGG - Intergenic
1148544070 17:48503622-48503644 CAGCAGGGCTGGATGGGGTGAGG - Intergenic
1148554017 17:48567078-48567100 CCCAAGGCTGGGATGGGTAGAGG - Intronic
1148574556 17:48700233-48700255 GAGAATACGTGGATGGGGAGGGG + Intergenic
1148785824 17:50145774-50145796 CAGGAGGGGTGGAAGGGGAGAGG + Intronic
1148866139 17:50629705-50629727 AAGGAGGCTGGGATGGGGAGTGG + Intergenic
1148866648 17:50632215-50632237 AGGAAGGCTTTGACGGGGAGGGG + Intergenic
1151670498 17:75569327-75569349 TAGCAGGCTGGGCTGGGGAGGGG + Intronic
1151764498 17:76125165-76125187 CAGAAGGCAGGGATTGGGACAGG + Intergenic
1152072133 17:78139146-78139168 GACAAGGCTTGGGTGGGAAGGGG - Exonic
1152383690 17:79956130-79956152 CAGGAGGCTTGGGTGGGCGGAGG - Intronic
1152870607 17:82751510-82751532 CAGCATGCGTGGACGGGGAGGGG - Intergenic
1153084678 18:1271037-1271059 GAGGAGGATAGGATGGGGAGAGG + Intergenic
1153426236 18:4967628-4967650 CACAAGGCTCGGAAGGGTAGTGG + Intergenic
1153550643 18:6258415-6258437 CGGTGGGCATGGATGGGGAGAGG + Intronic
1153571831 18:6481356-6481378 TAGGAGGGTAGGATGGGGAGGGG - Intergenic
1154009803 18:10564853-10564875 CCCAGGGCTTGGATGGGAAGTGG + Intergenic
1154171482 18:12056207-12056229 CAGGAGGCCTGGAAGGGGAGGGG + Intergenic
1154388800 18:13918920-13918942 GAGAAGGTGTGGAGGGGGAGTGG + Intergenic
1155544136 18:26898071-26898093 CAGAGGGTTCGGGTGGGGAGAGG - Intergenic
1156630064 18:38956491-38956513 CAGAACATTTGGGTGGGGAGAGG - Intergenic
1157537907 18:48474077-48474099 CAGTGGGCTGGGATGGGGGGTGG + Intergenic
1158255142 18:55537845-55537867 TAGAAGGCTGGGAGGGGAAGTGG - Intronic
1158326599 18:56319810-56319832 CAGAAGGATGGGATTGGGAGGGG - Intergenic
1158556956 18:58483255-58483277 GAGAATGCATTGATGGGGAGGGG - Intronic
1160004762 18:75061667-75061689 CACAGGGCTTGGGTGGGCAGTGG - Intronic
1160313238 18:77817402-77817424 CAGAGGTCTTGGAAAGGGAGTGG + Intergenic
1160657770 19:282068-282090 CACTAGGGTTGGCTGGGGAGTGG + Intronic
1161058003 19:2200275-2200297 CAGAAGGGATGGATGGAGACAGG - Intronic
1161636469 19:5392508-5392530 CAGAAGGCTGTCACGGGGAGGGG - Intergenic
1162046210 19:8002106-8002128 AAGAAGGCTGAGATGGGTAGTGG - Intronic
1162139214 19:8575803-8575825 CAGAGGGCTTCCTTGGGGAGGGG + Intronic
1162296800 19:9819207-9819229 CGGAAGGCGTGGCTGGGGTGGGG + Intronic
1162296820 19:9819268-9819290 CGGAAGGCGTGGCTGGGGAGGGG + Intronic
1162296856 19:9819390-9819412 CAGAAGGCGGGGCTGGGGCGCGG + Intronic
1162296874 19:9819446-9819468 CAGAAGGCGTGGCTGGGGTGGGG + Intronic
1162843538 19:13373608-13373630 CAGAAGGGTTGGAGAAGGAGAGG - Intronic
1162988591 19:14287934-14287956 GAGAAGGCTTCCCTGGGGAGGGG + Intergenic
1163115786 19:15187988-15188010 CTGAAGCCTGGGGTGGGGAGTGG + Exonic
1163631021 19:18417863-18417885 CAGAAGGCTTGGGGTGGGGGCGG + Intergenic
1164736257 19:30543609-30543631 CAGAGGCCTTGGCTGGGAAGCGG + Intronic
1165073257 19:33267697-33267719 CAGACAGCTGGGCTGGGGAGGGG + Intergenic
1165424155 19:35736813-35736835 CAGAGAGCTTGGAGGGTGAGTGG + Exonic
1165502172 19:36198471-36198493 CTGAAGGCTGGGAAGGGTAGAGG + Intronic
1168317980 19:55492333-55492355 GAGAAGGCTTGTATGGGGTGGGG + Intronic
1168454314 19:56494090-56494112 GAGAAGACCTGAATGGGGAGGGG + Intergenic
1202636630 1_KI270706v1_random:49816-49838 CAGCAGGATGGGATGGGCAGGGG - Intergenic
925317188 2:2935581-2935603 CAGAGGCCTTGGATGGGGCCAGG - Intergenic
926157615 2:10465922-10465944 CACCATGCTTGGATGGGGAAGGG + Intergenic
926182109 2:10653652-10653674 CAGAGGGCTCGGTTGGGGTGGGG - Intronic
927492029 2:23527048-23527070 TAGGAAGCTAGGATGGGGAGTGG + Intronic
928093556 2:28390962-28390984 CAGGACGCAGGGATGGGGAGGGG + Intergenic
928400430 2:30974114-30974136 CAGCAGGCTTGGCTGAGGTGTGG - Intronic
929041046 2:37745013-37745035 CAGGAGGCTGGGAAGGGTAGTGG + Intergenic
929778494 2:44942945-44942967 CAGAGGCCTGGGAAGGGGAGAGG + Intronic
930031021 2:47058112-47058134 CAGATGGCTGGTAGGGGGAGGGG - Intronic
932438103 2:71715103-71715125 GAGAGGGCTTGGATGGGATGTGG - Intergenic
932772708 2:74509975-74509997 CAGAAGGCTAGGAGAGTGAGCGG + Intergenic
934525835 2:95050964-95050986 GAGAAGGCTTGGCTGGGATGGGG - Intronic
934582181 2:95451802-95451824 AAGAAGGCTGGGGTGGGGTGCGG - Intergenic
934597269 2:95624912-95624934 AAGAAGGCTGGGGTGGGGTGCGG + Intergenic
934842618 2:97638080-97638102 AAGAAGGCTGGGGTGGGGTGCGG - Intergenic
935171397 2:100613604-100613626 CAGAAGGGTGGGAAGGGGTGGGG - Intergenic
935216639 2:100980212-100980234 CAGTTGGCTTGGAAAGGGAGTGG - Intronic
935632395 2:105222912-105222934 CAGAGGGCTGGGAGGGGGAAGGG - Intergenic
935811575 2:106803351-106803373 CATCAGGCTTGGATGGGCAAGGG - Exonic
936983037 2:118281698-118281720 CAAAAGATCTGGATGGGGAGAGG - Intergenic
937009830 2:118552461-118552483 CAGTAGGCTGGAATGGGGAAGGG - Intergenic
937352090 2:121172404-121172426 CTTCAGGCTTGGAAGGGGAGGGG - Intergenic
937879020 2:126851193-126851215 CAGAAGGCTGGGTGGGGCAGAGG + Intergenic
937958307 2:127436250-127436272 CAGAAGCTTTTGAAGGGGAGTGG - Intronic
938055890 2:128214469-128214491 CGGAAGGGTGGGTTGGGGAGGGG - Intergenic
939074005 2:137578661-137578683 CTGAATGCTTGGGTGGGGTGGGG - Intronic
939688287 2:145226569-145226591 CAGAAACCTTGGATAGGGTGGGG - Intergenic
942084266 2:172428978-172429000 CTCAAGGCCTGGGTGGGGAGGGG - Intronic
942449637 2:176100803-176100825 CAGAGGCCTTGTTTGGGGAGGGG + Exonic
942863982 2:180650090-180650112 GAGAGGGCTTGGATGGGAAGAGG - Intergenic
944165072 2:196710226-196710248 CAGCAGCCTGGCATGGGGAGGGG - Intronic
944474594 2:200090761-200090783 CAGCTGGCTTGGATTTGGAGGGG - Intergenic
944568038 2:201011403-201011425 TTGAAGGCTTGGATAAGGAGGGG + Exonic
945960815 2:216133033-216133055 TAGAAGGCTTGTTTGGGGTGGGG + Intronic
946231725 2:218295599-218295621 CAGCAAGCTAGGATGGGGGGTGG + Intronic
946352133 2:219162072-219162094 CAGAGGTTTTGGATGGGGAAAGG + Exonic
947428304 2:230003821-230003843 CAGAAGACTTGGTTGGGCATGGG - Intronic
947713922 2:232330537-232330559 CAGAGGGGATGGGTGGGGAGAGG - Intronic
947866572 2:233402033-233402055 CACTGGGCTTGGCTGGGGAGAGG - Intronic
948036632 2:234863338-234863360 CAGAAGACTTGTGTAGGGAGGGG + Intergenic
948157252 2:235793244-235793266 CAGAAGGCCTGGCTGGGAATGGG + Intronic
948385158 2:237576319-237576341 CTCAAGGCTTGGAGGGGCAGTGG - Intronic
1169522666 20:6390147-6390169 AAGAAAGCATGGATGTGGAGTGG - Intergenic
1169558161 20:6770243-6770265 CAGAGGGCTGGGATGAGGGGCGG - Exonic
1170602041 20:17848706-17848728 CAGATGGCTGGGAGGTGGAGGGG + Intergenic
1171882765 20:30630747-30630769 CAGCAGGATGGGATGGGCAGGGG - Intergenic
1172295237 20:33805335-33805357 CAGACTGCTTAGATGTGGAGGGG + Intergenic
1172770196 20:37377798-37377820 CAAAAGTGTGGGATGGGGAGAGG - Intronic
1173186399 20:40843697-40843719 CAGAGGGGTGGGATGGGGAAGGG - Intergenic
1173194935 20:40906339-40906361 CTGATGGATTGGATGTGGAGGGG - Intergenic
1173230507 20:41192414-41192436 CAGAATGCTTGGATAGGGAGTGG + Intronic
1174052453 20:47776499-47776521 CAGGAGGGTAGGTTGGGGAGTGG + Intronic
1174185058 20:48700721-48700743 CAGGAGGCTGGGATGGGGTCTGG - Intronic
1174381088 20:50155783-50155805 CTTAAGGCTTGGGTGGGGGGCGG + Intergenic
1174566543 20:51468841-51468863 CAGGGGCCTTGGATGAGGAGGGG + Intronic
1174934391 20:54851892-54851914 GAGATGGCAGGGATGGGGAGAGG - Intergenic
1175263557 20:57689401-57689423 CAGAAAGGTCGGCTGGGGAGTGG + Intronic
1175470633 20:59224411-59224433 AAGAAGGCTGGGATGGGACGAGG - Intronic
1175774910 20:61647060-61647082 CAGGATGCTTGGAGGGAGAGAGG + Intronic
1176299374 21:5091258-5091280 CAGCAGGCTGGGAGGGTGAGAGG + Intergenic
1178617272 21:34145083-34145105 CAGAAGGCTGGCATCGGGTGAGG + Intergenic
1179252043 21:39678745-39678767 CTGAAGGCTTGACTGGGGATGGG + Intergenic
1179645230 21:42771426-42771448 CAGGAGGCTGGGAGGGGCAGAGG - Intronic
1179857652 21:44170689-44170711 CAGCAGGCTGGGAGGGTGAGAGG - Intergenic
1180364240 22:11924497-11924519 CAGCAGGATGGGATGGGCAGGGG + Intergenic
1180842475 22:18965785-18965807 CAGCAGGAGTGGGTGGGGAGTGG - Intergenic
1181059011 22:20273071-20273093 CAGCAGGAGTGGGTGGGGAGTGG + Intronic
1181916000 22:26280629-26280651 CATAAGGGTGGGGTGGGGAGAGG - Intronic
1181998782 22:26903590-26903612 CAGAAGGCAGGGAGGGGGTGGGG + Intergenic
1182411391 22:30189883-30189905 CAGCAGGCCTGGGTGGGGTGTGG - Intergenic
1182542083 22:31049050-31049072 AAGAAGCCTTTGATGGGTAGAGG - Intergenic
1182691172 22:32164368-32164390 GAGACGGGGTGGATGGGGAGGGG + Intergenic
1182942809 22:34294104-34294126 CAAATGGCTTGTATGTGGAGGGG + Intergenic
1183184093 22:36282071-36282093 CAGAAGGCTGGGGTGGGGGGAGG - Exonic
1183928617 22:41223554-41223576 CAGAGGGCTGGGAGGGGGCGGGG + Intronic
1183948142 22:41338420-41338442 TACAGGGCTGGGATGGGGAGGGG - Intronic
1184340145 22:43881525-43881547 CAGAGGGCAGGGATGGAGAGGGG - Intronic
1185137245 22:49079941-49079963 CGGGAGGCTGGGTTGGGGAGGGG + Intergenic
1185165624 22:49260632-49260654 CAGCAGTCTTTGCTGGGGAGGGG + Intergenic
1203293315 22_KI270736v1_random:16589-16611 CAGGAGGCTGGGAAGGGTAGTGG + Intergenic
950155555 3:10719038-10719060 CAGTGAGCTTGGATGGAGAGTGG - Intergenic
950430462 3:12947993-12948015 CAGAAAGCCTGGGTGGGGCGGGG - Intronic
950704047 3:14769224-14769246 CAGAGGGCTTGGCAGAGGAGGGG + Intronic
950758412 3:15197741-15197763 CAGACTGCGGGGATGGGGAGGGG + Intergenic
951617751 3:24567134-24567156 CAGCAGACTTGGCTGGGGAAGGG + Intergenic
951656060 3:25009754-25009776 CAGAAGACTTAGAGGGGGATGGG + Intergenic
951847798 3:27103380-27103402 CAGAATCCTGGGATGGGGACTGG + Intergenic
953417389 3:42730827-42730849 CACAGGGCTTGGATGGACAGAGG - Intronic
954154530 3:48678162-48678184 CAGGTGGCATGGATGGGGTGGGG - Intronic
954698558 3:52440230-52440252 CAGAGGGCCTGGGTGGGGTGGGG - Intronic
954809792 3:53240868-53240890 CAGAAGGGTAGCTTGGGGAGAGG + Intronic
955665652 3:61346667-61346689 AAGAAGGAAAGGATGGGGAGAGG + Intergenic
955787528 3:62556025-62556047 TAGAAGGCTAGGGTGAGGAGTGG - Intronic
956095841 3:65715002-65715024 AAGATGGGTGGGATGGGGAGAGG + Intronic
956487563 3:69739296-69739318 CAGAAGGCCAGGCGGGGGAGAGG - Intergenic
956837558 3:73107924-73107946 CAGGAGGCTTGGGTGGGGCGGGG - Intergenic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
957789321 3:84918949-84918971 CAGAAGGGGTGGCTGGGCAGAGG - Intergenic
960473589 3:118096742-118096764 CAGAAGGCTGGGAAGGTGGGAGG - Intergenic
960812258 3:121636340-121636362 AAGAAGGCTGGGAGAGGGAGGGG - Intronic
961641093 3:128365207-128365229 AACAAGGCCTGGGTGGGGAGGGG + Intronic
961752102 3:129102797-129102819 CAGCTGGCTTGGTTGGGGTGGGG - Intronic
962355055 3:134686505-134686527 CAGAAGCCTTGCAGGGGAAGTGG + Intronic
962852483 3:139318414-139318436 TGGAAGGGCTGGATGGGGAGGGG + Intronic
962973230 3:140424391-140424413 CAGTAGGCTGGGAGGAGGAGAGG - Intronic
964367139 3:155962265-155962287 CAGAAGGGGTGGCTGGGCAGAGG + Intergenic
964670467 3:159219824-159219846 CTGCAGGCTTGGATGTGAAGTGG - Intronic
965559550 3:170048260-170048282 CAGAAGGGCAGGATGGGAAGGGG + Intronic
965560274 3:170055462-170055484 CAGAAGCCCGGGATGGAGAGTGG + Intronic
966119668 3:176507811-176507833 CAGAAGCCTTAGTGGGGGAGTGG - Intergenic
967518512 3:190400184-190400206 CTGAAGGCTGGGAAGGGTAGGGG - Intronic
967942817 3:194779421-194779443 CGGAGGCCTTTGATGGGGAGTGG - Intergenic
968867726 4:3224577-3224599 CGGAAGGCTTGGTGGGAGAGTGG - Intronic
969668920 4:8578978-8579000 CAGAAGCCTTGGAGGGGTTGGGG + Intronic
969875585 4:10133561-10133583 CAGAGGGCATGGATGGGGGTGGG - Intergenic
970557534 4:17249674-17249696 CATATGGCTATGATGGGGAGTGG - Intergenic
972706051 4:41544081-41544103 GAGAAGGCTTGGTGGGGGTGGGG - Intronic
972908593 4:43784756-43784778 CAGAAGGAGGGGAGGGGGAGTGG + Intergenic
973366443 4:49213186-49213208 CAGCAGGATGGGATGGGCAGGGG - Intergenic
973605991 4:52588353-52588375 CATAGGGCTGGGGTGGGGAGGGG - Intergenic
974870655 4:67637365-67637387 CAGAAGGGGTGGCTGGGCAGAGG - Intronic
975364303 4:73510690-73510712 CAGAAGGATTGCCTGGGGACAGG - Intergenic
976107494 4:81634681-81634703 CACAAGGCGGGCATGGGGAGGGG - Intronic
978440662 4:108730111-108730133 CAGAAGGCTTGGAGCAGGAGGGG + Intergenic
979220795 4:118221436-118221458 GAGAAGGCTGGGAAGAGGAGAGG - Intronic
980079320 4:128327166-128327188 CAGGAGACTTGAATGTGGAGGGG - Intergenic
980968001 4:139542248-139542270 CAGGAGGGAAGGATGGGGAGAGG + Intronic
981288364 4:143046042-143046064 CTGGAGGCTTGGATTGGGTGAGG - Intergenic
981827693 4:148962658-148962680 AAGAAGGCTGTTATGGGGAGTGG - Intergenic
982089741 4:151870097-151870119 CAGTGGTCATGGATGGGGAGGGG - Intergenic
982129450 4:152214695-152214717 CAGAAGACTGGGATGAGGGGTGG + Intergenic
983713491 4:170749214-170749236 AAGAAGACTTGGAGGGAGAGGGG - Intergenic
983979589 4:173977822-173977844 CTGAAGGCTTGGCTGGGGCTGGG - Intergenic
984767237 4:183408964-183408986 CAGAGGGCTTGGTTGGGAGGGGG - Intergenic
985068269 4:186144461-186144483 CACCAGGCTGGGGTGGGGAGTGG - Intronic
1202763946 4_GL000008v2_random:135688-135710 CAGCAGGATGGGATGGGCAGGGG - Intergenic
986848685 5:11784802-11784824 CTGCAGGCTTGACTGGGGAGTGG - Intronic
987027038 5:13937941-13937963 CGGAAACCTTGGATGGGGATAGG - Intronic
987062835 5:14258749-14258771 CAGGAGGCTGGGATGGCTAGAGG - Intronic
989181937 5:38587162-38587184 TAGAGGGCTGGGGTGGGGAGGGG - Intronic
989332357 5:40274813-40274835 TAGAAAGCTTGGTTGGGGAGGGG - Intergenic
990339555 5:54808905-54808927 TAGAAGGCTGGGATGAAGAGGGG - Intergenic
991663500 5:68973780-68973802 CTGATGCCTGGGATGGGGAGGGG - Intergenic
992880633 5:81105769-81105791 GAAAAGGATTGGATGGGGAGAGG - Intronic
997233902 5:132261649-132261671 AAGAAGGCTAGAATGGGGGGTGG - Intronic
997455755 5:134016294-134016316 CACATGGCTGTGATGGGGAGTGG + Intergenic
997475101 5:134138166-134138188 TACAAGCCTGGGATGGGGAGGGG + Intronic
997481211 5:134185953-134185975 CAGAAGGCTTGGACCAGGACAGG + Intronic
998104811 5:139461776-139461798 AAGAGGGCTCAGATGGGGAGGGG - Intronic
998385716 5:141756159-141756181 CAAAATGCTTGGCTGGGGTGGGG + Intergenic
998394703 5:141811375-141811397 GAAGAGGCTGGGATGGGGAGAGG - Intergenic
998699713 5:144684135-144684157 CAGCAGGCTGGGAGGAGGAGAGG - Intergenic
999231590 5:150065194-150065216 CAGCAGGCCTAGATGGGGAGGGG - Intronic
999737108 5:154521167-154521189 AAGAAGGGTTGGTTTGGGAGGGG + Intergenic
1000003828 5:157165072-157165094 CAGAAGGGTTGGAGGGGGTGAGG + Intronic
1000042226 5:157493269-157493291 CAGCAGGCTTGCGTGGGGTGGGG + Intronic
1000979246 5:167798983-167799005 CAGGAGGCTTTGATGGGGTTAGG + Intronic
1001779836 5:174358277-174358299 CAAAATGTTTGGATGGGGAGGGG + Intergenic
1001829331 5:174772518-174772540 CTGAAGGCTTGGTTGGGGCTGGG - Intergenic
1001844536 5:174910303-174910325 CAGAAGCCTGGGCTGGGGAGTGG - Intergenic
1002302446 5:178265008-178265030 CAGAAGGAATGGCTGGGGTGGGG + Intronic
1002474126 5:179454307-179454329 CTGATGGATTGGATGGGGGGCGG - Intergenic
1002526602 5:179819015-179819037 CTGGAGGCTGGGCTGGGGAGTGG - Intronic
1002662675 5:180802543-180802565 GAGGGGGCTTGGCTGGGGAGCGG - Intronic
1004160239 6:13206169-13206191 GAGAGGGGTTGGCTGGGGAGGGG + Intronic
1005267697 6:24129634-24129656 CAGAAGAATTTGATAGGGAGTGG + Intronic
1005433348 6:25781680-25781702 CAGGAAGCTGGGAGGGGGAGAGG + Intergenic
1005822004 6:29606308-29606330 TAGAGGGCTTGGAGGGAGAGGGG - Intronic
1006387920 6:33742256-33742278 CAGTCTGCTTGGACGGGGAGTGG + Intronic
1006392663 6:33767820-33767842 CTGAGGGCTTGGATGGGGTGAGG - Intergenic
1007504863 6:42327848-42327870 CAGAAGGCATGGTGGGGGTGAGG + Intronic
1007791215 6:44309727-44309749 CTGATGGATTAGATGGGGAGGGG - Intronic
1007830097 6:44631181-44631203 GAGAAGGTTGGGAAGGGGAGTGG + Intergenic
1007872519 6:45056699-45056721 GGGAAGGCTGGGATGGGGTGAGG + Intronic
1007924372 6:45639777-45639799 CAGGAGGATGGAATGGGGAGGGG + Intronic
1009621497 6:66084095-66084117 TAGATGTCTTGGATGGGGATTGG + Intergenic
1012021260 6:93923276-93923298 CAGTAGCATTGGATGGGGTGAGG - Intergenic
1013162117 6:107554846-107554868 CAGAGGGCTGGGATGGGGGGTGG + Intronic
1015165859 6:130199292-130199314 CTGCAGGCTTGGATGTAGAGAGG - Intronic
1015419110 6:132986183-132986205 CAGCAGCCTGGCATGGGGAGGGG - Intergenic
1015751687 6:136566334-136566356 CAGAAGGCATGGGTGGGAGGAGG + Intronic
1016528699 6:145034542-145034564 CAGAAGGCGTTTTTGGGGAGAGG + Intergenic
1016912406 6:149212046-149212068 ATGAAGGCTTGGAAAGGGAGAGG + Intergenic
1017827380 6:158091935-158091957 AAGGAGGCCTGGGTGGGGAGTGG + Intronic
1018887597 6:167953702-167953724 CAGAGAGCTCTGATGGGGAGGGG - Intronic
1019323416 7:425884-425906 GAGCAGGCTTGGGGGGGGAGTGG - Intergenic
1019937922 7:4268408-4268430 CTGAAGGCGAGGCTGGGGAGAGG - Exonic
1021161011 7:17272687-17272709 CAGAAGGCTTGGAAAGGAAGGGG - Intergenic
1022428315 7:30289491-30289513 TTGAAGGCTTTTATGGGGAGTGG + Intronic
1022698392 7:32732678-32732700 TTGAAGGCTTTTATGGGGAGTGG + Intergenic
1022720168 7:32935448-32935470 CAGAAGTCTTGATAGGGGAGAGG + Intergenic
1023626360 7:42118985-42119007 CAGGAGGCTTATATGGAGAGTGG - Intronic
1023910027 7:44547251-44547273 CACAAGGACAGGATGGGGAGGGG + Intergenic
1023921481 7:44633543-44633565 AGGGAGTCTTGGATGGGGAGGGG - Intronic
1026247186 7:68631376-68631398 CCAAAGGCTTGGAAGGGTAGTGG - Intergenic
1026336652 7:69399454-69399476 CAGAAGGGATAGATGGGGAAAGG - Intergenic
1026455932 7:70572443-70572465 GAGAAGGCAGGGATGGGGGGTGG + Intronic
1026647343 7:72183308-72183330 AAGAAGGCAAGGAGGGGGAGAGG + Intronic
1026795157 7:73361615-73361637 CAGGAGGCTGGGCTGGGGACAGG - Intergenic
1026959267 7:74398384-74398406 CAGGAGGATGGGATGGGGATGGG - Intronic
1029278296 7:99420489-99420511 GAGGTGGCTTTGATGGGGAGGGG - Intronic
1029673696 7:102051222-102051244 CAGAAGGCTTCAGTGGGGAGAGG - Intronic
1029700765 7:102245492-102245514 CCTAAGGCTGGGGTGGGGAGCGG - Intronic
1029722025 7:102374320-102374342 CAGAAGGCAAGGAGGTGGAGGGG - Intronic
1031149794 7:118040295-118040317 CACAAGGCTGGGGTGGGGGGTGG - Intergenic
1031196150 7:118616569-118616591 AAGAAAGCACGGATGGGGAGAGG + Intergenic
1032077164 7:128841419-128841441 AAGAAGGCTGAGTTGGGGAGGGG - Intronic
1032261927 7:130345283-130345305 GAGATAGTTTGGATGGGGAGGGG + Exonic
1033813277 7:145042976-145042998 CATAAGGCTTGGATGGTAGGAGG + Intergenic
1034473639 7:151270094-151270116 CAGATGGCTTGGAGGGAGAAAGG + Intronic
1035382448 7:158448487-158448509 CAGGAGGGTGGGGTGGGGAGGGG + Intronic
1035588645 8:796468-796490 CTGGAGGTTTGGGTGGGGAGGGG + Intergenic
1036208858 8:6825871-6825893 CTGGAGGCTTTGCTGGGGAGTGG + Intronic
1036457074 8:8919111-8919133 CAGAAGTGTTGGGGGGGGAGCGG - Intergenic
1036581277 8:10078143-10078165 CAGGTGTTTTGGATGGGGAGAGG + Intronic
1036690381 8:10941225-10941247 CTGAAGGGTTGCCTGGGGAGGGG - Intronic
1037725859 8:21482274-21482296 CAGTGGGCTTGGCTTGGGAGGGG + Intergenic
1038529777 8:28308962-28308984 CAGAAGCCTTGGCAGGGTAGGGG + Intergenic
1038660731 8:29494255-29494277 CAGAAGGCTGTGATGGGGAAAGG + Intergenic
1038764616 8:30415625-30415647 CAAGAGTCTTGGATGGGGAGAGG + Intronic
1041797391 8:61760009-61760031 CAAAAGACCTGGAAGGGGAGGGG - Intergenic
1042501481 8:69514246-69514268 CAGGAAGCATGGATGGGGAAGGG + Intronic
1043369918 8:79578748-79578770 CAGAGGCTTGGGATGGGGAGAGG - Intergenic
1043705066 8:83338670-83338692 GAGAAGGCTTGCAGGGAGAGTGG + Intergenic
1043891180 8:85654321-85654343 CAGAGGTCTCGGATGGGCAGAGG + Intergenic
1043892255 8:85661158-85661180 CAGAGGTCTCGGATGGGCAGAGG + Intergenic
1043893307 8:85716182-85716204 CAGAGGTCTCGGATGGGCAGAGG - Intergenic
1043895990 8:85737631-85737653 CAGAGGTCTCGGATGGGCAGAGG - Intergenic
1043896689 8:85744177-85744199 CAGAGGTCTCGGATGGGCAGAGG + Intergenic
1043899012 8:85762544-85762566 CAGAGGTCTCGGATGGGCAGAGG + Intergenic
1043900623 8:85774738-85774760 CAGAGGTCTCGGATGGGCAGAGG + Intergenic
1043902587 8:85790013-85790035 CAGAGGTCTCGGATGGGCAGAGG + Intergenic
1043904197 8:85802206-85802228 CAGAGGTCTCGGATGGGCAGAGG + Intergenic
1043905809 8:85814400-85814422 CAGAGGTCTCGGATGGGCAGAGG + Intergenic
1043907417 8:85826587-85826609 CAGAGGTCTCGGATGGGCAGAGG + Intergenic
1044576956 8:93780089-93780111 CAGCAGGCTGGCAGGGGGAGGGG - Intronic
1047585912 8:126272287-126272309 CAGAAGGCTTGGTGGGGTGGTGG - Intergenic
1047622167 8:126618883-126618905 CTGAGGGCTTGTAGGGGGAGAGG - Intergenic
1047655959 8:126977408-126977430 CAGAATGCTAGAATGGGAAGAGG - Intergenic
1048085385 8:131172358-131172380 CAGCAGGCTTGGAAGGCAAGAGG + Intergenic
1049034622 8:140064878-140064900 CAGGAGACTTGGATGGGTAGAGG - Intronic
1049591998 8:143466836-143466858 GAGCAGGCTGGGAAGGGGAGGGG - Intronic
1049678534 8:143904592-143904614 CAGAGGGCTGATATGGGGAGGGG - Intergenic
1050097512 9:2082157-2082179 AAACAGGCTAGGATGGGGAGGGG - Intronic
1050284315 9:4085531-4085553 CAGAAGGATAGAATGGGCAGGGG - Intronic
1050635473 9:7607782-7607804 CAGAACACATGGGTGGGGAGGGG + Intergenic
1050806839 9:9691286-9691308 CAAAAGGCTAGGAAGGGTAGTGG - Intronic
1051528614 9:18075430-18075452 CAGAAGGGTGGGATAGGGTGGGG - Intergenic
1052997103 9:34557015-34557037 CAGAAGGTCTGGCTGGGGCGGGG + Intronic
1053147872 9:35724164-35724186 CAGAGGACTTGGCTGGGGTGGGG - Intronic
1056580667 9:87886509-87886531 CAGAAGGCTGGGAGGGCAAGAGG - Exonic
1056816575 9:89806117-89806139 GAGAAGGAGTGGAAGGGGAGCGG + Intergenic
1056897745 9:90566675-90566697 CAGGAGGCCTGGGTGGGGTGAGG - Intergenic
1057486966 9:95493222-95493244 CAGAAGGCTGTGCTGAGGAGGGG - Intronic
1058751026 9:108038372-108038394 CAGGAGGCATGGAAGGGAAGGGG - Intergenic
1060733206 9:126050705-126050727 CAGAAGGCAGGGGAGGGGAGGGG - Intergenic
1060931499 9:127492136-127492158 AAGAAGGCCTGGAGGGGCAGAGG - Intronic
1061202873 9:129147532-129147554 CAGAGGGAGGGGATGGGGAGGGG - Exonic
1061520102 9:131112767-131112789 CAGGTGGCTGGGATGGGGTGGGG - Intronic
1061859931 9:133462803-133462825 CATAAGGCCAGGAAGGGGAGGGG - Intronic
1062263892 9:135678045-135678067 TGCAAGGCTGGGATGGGGAGAGG - Intergenic
1062285731 9:135771768-135771790 AGGAAGGCCTGGCTGGGGAGGGG - Intronic
1203544694 Un_KI270743v1:120561-120583 CAGCAGGATGGGATGGGCAGGGG - Intergenic
1185537363 X:872913-872935 GAGAAGGCAGGGAAGGGGAGTGG - Intergenic
1186720307 X:12296821-12296843 AAGAAGGCTGGGATGGGGAAAGG + Intronic
1189335677 X:40169581-40169603 CAGAAGGCTTGGTTGAAGAGGGG - Intronic
1190049608 X:47140024-47140046 CAGAAGGCAAGGATGGGTATGGG + Intergenic
1192277486 X:69648508-69648530 CAGATGGCCTGGATGGGGAAGGG - Intronic
1192965846 X:76175899-76175921 CAGAAGGCTTGGATGGGGAGTGG + Intronic
1193600665 X:83505768-83505790 CCAGAGGCTTGGAGGGGGAGAGG - Intergenic
1194887855 X:99340019-99340041 TAGAAGGATGGGATGGGTAGTGG - Intergenic
1195118442 X:101723799-101723821 CAGAAGGAATGGAAGGTGAGAGG - Intergenic
1195658387 X:107355061-107355083 CAAAAGGCTAGGAAGGAGAGTGG + Intergenic
1195863328 X:109404140-109404162 CAGAAAGCTTGGCTGGGCCGAGG + Intronic
1195930087 X:110065589-110065611 CTGAGGGGTGGGATGGGGAGTGG + Intronic
1196462468 X:115944762-115944784 CAAATGGGTTGGATGGGGAGGGG - Intergenic
1197873095 X:131078652-131078674 CAGATGGGTGGGGTGGGGAGGGG - Intronic
1198694707 X:139323602-139323624 CAGAAAGCTTGGATGTTAAGGGG + Intergenic
1199685046 X:150258211-150258233 CAGAGGGCCAGGAAGGGGAGGGG - Intergenic
1199712487 X:150480024-150480046 CAGAAGCACAGGATGGGGAGGGG - Intronic
1200288783 X:154851049-154851071 CAGAAGGAGTGAATGTGGAGTGG - Intronic