ID: 1192979125

View in Genome Browser
Species Human (GRCh38)
Location X:76319542-76319564
Sequence TCATCTGGACACCCTCCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192979118_1192979125 6 Left 1192979118 X:76319513-76319535 CCTTCTGCCTGTGGAATTTTACC No data
Right 1192979125 X:76319542-76319564 TCATCTGGACACCCTCCTGATGG No data
1192979119_1192979125 -1 Left 1192979119 X:76319520-76319542 CCTGTGGAATTTTACCCCCTGCT No data
Right 1192979125 X:76319542-76319564 TCATCTGGACACCCTCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192979125 Original CRISPR TCATCTGGACACCCTCCTGA TGG Intergenic