ID: 1192981987

View in Genome Browser
Species Human (GRCh38)
Location X:76353867-76353889
Sequence GATGGGGCAAGCCCCACTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192981982_1192981987 -8 Left 1192981982 X:76353852-76353874 CCATCCCCCACAGCGGATGGGGC No data
Right 1192981987 X:76353867-76353889 GATGGGGCAAGCCCCACTCAAGG No data
1192981975_1192981987 15 Left 1192981975 X:76353829-76353851 CCATTGGACTGGGAACCACACTC No data
Right 1192981987 X:76353867-76353889 GATGGGGCAAGCCCCACTCAAGG No data
1192981980_1192981987 -7 Left 1192981980 X:76353851-76353873 CCCATCCCCCACAGCGGATGGGG No data
Right 1192981987 X:76353867-76353889 GATGGGGCAAGCCCCACTCAAGG No data
1192981972_1192981987 30 Left 1192981972 X:76353814-76353836 CCTGGGAATATAACTCCATTGGA No data
Right 1192981987 X:76353867-76353889 GATGGGGCAAGCCCCACTCAAGG No data
1192981976_1192981987 0 Left 1192981976 X:76353844-76353866 CCACACTCCCATCCCCCACAGCG No data
Right 1192981987 X:76353867-76353889 GATGGGGCAAGCCCCACTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192981987 Original CRISPR GATGGGGCAAGCCCCACTCA AGG Intergenic