ID: 1192983595

View in Genome Browser
Species Human (GRCh38)
Location X:76372700-76372722
Sequence ATGCCCTTCTAGAATAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192983593_1192983595 2 Left 1192983593 X:76372675-76372697 CCAAGGAAAAAGGACTTACCAAA No data
Right 1192983595 X:76372700-76372722 ATGCCCTTCTAGAATAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192983595 Original CRISPR ATGCCCTTCTAGAATAGTGA AGG Intergenic
No off target data available for this crispr