ID: 1192988182

View in Genome Browser
Species Human (GRCh38)
Location X:76422998-76423020
Sequence TTGAATGTACAAATGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192988182_1192988184 5 Left 1192988182 X:76422998-76423020 CCATTGTCCATTTGTACATTCAA No data
Right 1192988184 X:76423026-76423048 CAGTATACATCCCACCATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192988182 Original CRISPR TTGAATGTACAAATGGACAA TGG (reversed) Intergenic
No off target data available for this crispr