ID: 1192995140

View in Genome Browser
Species Human (GRCh38)
Location X:76505484-76505506
Sequence TTCTGTAGCTAGGAGGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192995134_1192995140 15 Left 1192995134 X:76505446-76505468 CCGTGGAAGATGGGGCTGAGATT No data
Right 1192995140 X:76505484-76505506 TTCTGTAGCTAGGAGGATTATGG No data
1192995137_1192995140 -9 Left 1192995137 X:76505470-76505492 CCAGATCACTGGAGTTCTGTAGC No data
Right 1192995140 X:76505484-76505506 TTCTGTAGCTAGGAGGATTATGG No data
1192995136_1192995140 -8 Left 1192995136 X:76505469-76505491 CCCAGATCACTGGAGTTCTGTAG No data
Right 1192995140 X:76505484-76505506 TTCTGTAGCTAGGAGGATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192995140 Original CRISPR TTCTGTAGCTAGGAGGATTA TGG Intergenic
No off target data available for this crispr