ID: 1192999509

View in Genome Browser
Species Human (GRCh38)
Location X:76549520-76549542
Sequence TGATGTTAGGGTGTCAATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4798
Summary {0: 3374, 1: 944, 2: 244, 3: 60, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192999509_1192999512 -7 Left 1192999509 X:76549520-76549542 CCAAAATTGACACCCTAACATCA 0: 3374
1: 944
2: 244
3: 60
4: 176
Right 1192999512 X:76549536-76549558 AACATCACAATTAAAAGAACTGG 0: 115
1: 100
2: 68
3: 69
4: 470
1192999509_1192999513 9 Left 1192999509 X:76549520-76549542 CCAAAATTGACACCCTAACATCA 0: 3374
1: 944
2: 244
3: 60
4: 176
Right 1192999513 X:76549552-76549574 GAACTGGATTTATCTACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192999509 Original CRISPR TGATGTTAGGGTGTCAATTT TGG (reversed) Intergenic
Too many off-targets to display for this crispr