ID: 1192999510

View in Genome Browser
Species Human (GRCh38)
Location X:76549532-76549554
Sequence TTCTTTTAATTGTGATGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 13081
Summary {0: 7379, 1: 3417, 2: 1160, 3: 489, 4: 636}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192999510_1192999516 25 Left 1192999510 X:76549532-76549554 CCCTAACATCACAATTAAAAGAA 0: 7379
1: 3417
2: 1160
3: 489
4: 636
Right 1192999516 X:76549580-76549602 GATGTTGATGACCTTTGGATGGG No data
1192999510_1192999515 24 Left 1192999510 X:76549532-76549554 CCCTAACATCACAATTAAAAGAA 0: 7379
1: 3417
2: 1160
3: 489
4: 636
Right 1192999515 X:76549579-76549601 TGATGTTGATGACCTTTGGATGG No data
1192999510_1192999514 20 Left 1192999510 X:76549532-76549554 CCCTAACATCACAATTAAAAGAA 0: 7379
1: 3417
2: 1160
3: 489
4: 636
Right 1192999514 X:76549575-76549597 TCTTTGATGTTGATGACCTTTGG 0: 15
1: 361
2: 698
3: 648
4: 951
1192999510_1192999517 26 Left 1192999510 X:76549532-76549554 CCCTAACATCACAATTAAAAGAA 0: 7379
1: 3417
2: 1160
3: 489
4: 636
Right 1192999517 X:76549581-76549603 ATGTTGATGACCTTTGGATGGGG No data
1192999510_1192999513 -3 Left 1192999510 X:76549532-76549554 CCCTAACATCACAATTAAAAGAA 0: 7379
1: 3417
2: 1160
3: 489
4: 636
Right 1192999513 X:76549552-76549574 GAACTGGATTTATCTACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192999510 Original CRISPR TTCTTTTAATTGTGATGTTA GGG (reversed) Intergenic
Too many off-targets to display for this crispr