ID: 1192999511

View in Genome Browser
Species Human (GRCh38)
Location X:76549533-76549555
Sequence GTTCTTTTAATTGTGATGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 15250
Summary {0: 7382, 1: 3708, 2: 1613, 3: 893, 4: 1654}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192999511_1192999514 19 Left 1192999511 X:76549533-76549555 CCTAACATCACAATTAAAAGAAC 0: 7382
1: 3708
2: 1613
3: 893
4: 1654
Right 1192999514 X:76549575-76549597 TCTTTGATGTTGATGACCTTTGG 0: 15
1: 361
2: 698
3: 648
4: 951
1192999511_1192999513 -4 Left 1192999511 X:76549533-76549555 CCTAACATCACAATTAAAAGAAC 0: 7382
1: 3708
2: 1613
3: 893
4: 1654
Right 1192999513 X:76549552-76549574 GAACTGGATTTATCTACTTTTGG No data
1192999511_1192999517 25 Left 1192999511 X:76549533-76549555 CCTAACATCACAATTAAAAGAAC 0: 7382
1: 3708
2: 1613
3: 893
4: 1654
Right 1192999517 X:76549581-76549603 ATGTTGATGACCTTTGGATGGGG No data
1192999511_1192999515 23 Left 1192999511 X:76549533-76549555 CCTAACATCACAATTAAAAGAAC 0: 7382
1: 3708
2: 1613
3: 893
4: 1654
Right 1192999515 X:76549579-76549601 TGATGTTGATGACCTTTGGATGG No data
1192999511_1192999516 24 Left 1192999511 X:76549533-76549555 CCTAACATCACAATTAAAAGAAC 0: 7382
1: 3708
2: 1613
3: 893
4: 1654
Right 1192999516 X:76549580-76549602 GATGTTGATGACCTTTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192999511 Original CRISPR GTTCTTTTAATTGTGATGTT AGG (reversed) Intergenic
Too many off-targets to display for this crispr