ID: 1192999513

View in Genome Browser
Species Human (GRCh38)
Location X:76549552-76549574
Sequence GAACTGGATTTATCTACTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192999509_1192999513 9 Left 1192999509 X:76549520-76549542 CCAAAATTGACACCCTAACATCA 0: 3374
1: 944
2: 244
3: 60
4: 176
Right 1192999513 X:76549552-76549574 GAACTGGATTTATCTACTTTTGG No data
1192999511_1192999513 -4 Left 1192999511 X:76549533-76549555 CCTAACATCACAATTAAAAGAAC 0: 7382
1: 3708
2: 1613
3: 893
4: 1654
Right 1192999513 X:76549552-76549574 GAACTGGATTTATCTACTTTTGG No data
1192999510_1192999513 -3 Left 1192999510 X:76549532-76549554 CCCTAACATCACAATTAAAAGAA 0: 7379
1: 3417
2: 1160
3: 489
4: 636
Right 1192999513 X:76549552-76549574 GAACTGGATTTATCTACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192999513 Original CRISPR GAACTGGATTTATCTACTTT TGG Intergenic
No off target data available for this crispr