ID: 1193007983

View in Genome Browser
Species Human (GRCh38)
Location X:76642720-76642742
Sequence TTAAAGAAGAAGAATGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193007982_1193007983 16 Left 1193007982 X:76642681-76642703 CCATGATAATGCTGTCTATATTT No data
Right 1193007983 X:76642720-76642742 TTAAAGAAGAAGAATGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193007983 Original CRISPR TTAAAGAAGAAGAATGAGAA AGG Intergenic
No off target data available for this crispr