ID: 1193010473

View in Genome Browser
Species Human (GRCh38)
Location X:76669818-76669840
Sequence TAGCAAACTGCAGTACTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193010473_1193010479 5 Left 1193010473 X:76669818-76669840 CCCTCCAGTACTGCAGTTTGCTA No data
Right 1193010479 X:76669846-76669868 AAAGGGCCAAAGAACATCCAGGG No data
1193010473_1193010478 4 Left 1193010473 X:76669818-76669840 CCCTCCAGTACTGCAGTTTGCTA No data
Right 1193010478 X:76669845-76669867 CAAAGGGCCAAAGAACATCCAGG No data
1193010473_1193010480 6 Left 1193010473 X:76669818-76669840 CCCTCCAGTACTGCAGTTTGCTA No data
Right 1193010480 X:76669847-76669869 AAGGGCCAAAGAACATCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193010473 Original CRISPR TAGCAAACTGCAGTACTGGA GGG (reversed) Intergenic
No off target data available for this crispr