ID: 1193011888

View in Genome Browser
Species Human (GRCh38)
Location X:76685841-76685863
Sequence CTGTAGTAGATGAGTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193011886_1193011888 -1 Left 1193011886 X:76685819-76685841 CCTTGGTATCTAGATCATGCTGC No data
Right 1193011888 X:76685841-76685863 CTGTAGTAGATGAGTGAGGAAGG No data
1193011883_1193011888 25 Left 1193011883 X:76685793-76685815 CCTCTTTTTATTGTGTGCTCATC No data
Right 1193011888 X:76685841-76685863 CTGTAGTAGATGAGTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193011888 Original CRISPR CTGTAGTAGATGAGTGAGGA AGG Intergenic
No off target data available for this crispr