ID: 1193021460 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:76797762-76797784 |
| Sequence | CTGGGTATTCAAATCAAACA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1193021460_1193021473 | 27 | Left | 1193021460 | X:76797762-76797784 | CCATGTTTGATTTGAATACCCAG | No data | ||
| Right | 1193021473 | X:76797812-76797834 | CATATGAGGGATCTTGTGTTGGG | No data | ||||
| 1193021460_1193021467 | 13 | Left | 1193021460 | X:76797762-76797784 | CCATGTTTGATTTGAATACCCAG | No data | ||
| Right | 1193021467 | X:76797798-76797820 | AACGCTTTACCTCCCATATGAGG | No data | ||||
| 1193021460_1193021468 | 14 | Left | 1193021460 | X:76797762-76797784 | CCATGTTTGATTTGAATACCCAG | No data | ||
| Right | 1193021468 | X:76797799-76797821 | ACGCTTTACCTCCCATATGAGGG | No data | ||||
| 1193021460_1193021472 | 26 | Left | 1193021460 | X:76797762-76797784 | CCATGTTTGATTTGAATACCCAG | No data | ||
| Right | 1193021472 | X:76797811-76797833 | CCATATGAGGGATCTTGTGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1193021460 | Original CRISPR | CTGGGTATTCAAATCAAACA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||