ID: 1193021460

View in Genome Browser
Species Human (GRCh38)
Location X:76797762-76797784
Sequence CTGGGTATTCAAATCAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193021460_1193021473 27 Left 1193021460 X:76797762-76797784 CCATGTTTGATTTGAATACCCAG No data
Right 1193021473 X:76797812-76797834 CATATGAGGGATCTTGTGTTGGG No data
1193021460_1193021467 13 Left 1193021460 X:76797762-76797784 CCATGTTTGATTTGAATACCCAG No data
Right 1193021467 X:76797798-76797820 AACGCTTTACCTCCCATATGAGG No data
1193021460_1193021468 14 Left 1193021460 X:76797762-76797784 CCATGTTTGATTTGAATACCCAG No data
Right 1193021468 X:76797799-76797821 ACGCTTTACCTCCCATATGAGGG No data
1193021460_1193021472 26 Left 1193021460 X:76797762-76797784 CCATGTTTGATTTGAATACCCAG No data
Right 1193021472 X:76797811-76797833 CCATATGAGGGATCTTGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193021460 Original CRISPR CTGGGTATTCAAATCAAACA TGG (reversed) Intergenic
No off target data available for this crispr