ID: 1193029109

View in Genome Browser
Species Human (GRCh38)
Location X:76878991-76879013
Sequence GGAATTCTGCCTGAACATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193029101_1193029109 28 Left 1193029101 X:76878940-76878962 CCTCTGCATTGCCCTAGCAAAGT No data
Right 1193029109 X:76878991-76879013 GGAATTCTGCCTGAACATTCAGG No data
1193029103_1193029109 16 Left 1193029103 X:76878952-76878974 CCTAGCAAAGTTTCCTCATGAGG No data
Right 1193029109 X:76878991-76879013 GGAATTCTGCCTGAACATTCAGG No data
1193029106_1193029109 3 Left 1193029106 X:76878965-76878987 CCTCATGAGGGCTCTGATCCTGC No data
Right 1193029109 X:76878991-76879013 GGAATTCTGCCTGAACATTCAGG No data
1193029102_1193029109 17 Left 1193029102 X:76878951-76878973 CCCTAGCAAAGTTTCCTCATGAG No data
Right 1193029109 X:76878991-76879013 GGAATTCTGCCTGAACATTCAGG No data
1193029100_1193029109 29 Left 1193029100 X:76878939-76878961 CCCTCTGCATTGCCCTAGCAAAG No data
Right 1193029109 X:76878991-76879013 GGAATTCTGCCTGAACATTCAGG No data
1193029099_1193029109 30 Left 1193029099 X:76878938-76878960 CCCCTCTGCATTGCCCTAGCAAA No data
Right 1193029109 X:76878991-76879013 GGAATTCTGCCTGAACATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193029109 Original CRISPR GGAATTCTGCCTGAACATTC AGG Intergenic
No off target data available for this crispr