ID: 1193031902

View in Genome Browser
Species Human (GRCh38)
Location X:76907535-76907557
Sequence CCCTTGCCAGAAAGAGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193031896_1193031902 4 Left 1193031896 X:76907508-76907530 CCTGGATTAGGAGTTTAGGCCAC 0: 10
1: 15
2: 37
3: 51
4: 130
Right 1193031902 X:76907535-76907557 CCCTTGCCAGAAAGAGAAATTGG No data
1193031890_1193031902 28 Left 1193031890 X:76907484-76907506 CCAGACATCTGGAACACCCATTC No data
Right 1193031902 X:76907535-76907557 CCCTTGCCAGAAAGAGAAATTGG No data
1193031894_1193031902 11 Left 1193031894 X:76907501-76907523 CCATTCTCCTGGATTAGGAGTTT No data
Right 1193031902 X:76907535-76907557 CCCTTGCCAGAAAGAGAAATTGG No data
1193031893_1193031902 12 Left 1193031893 X:76907500-76907522 CCCATTCTCCTGGATTAGGAGTT No data
Right 1193031902 X:76907535-76907557 CCCTTGCCAGAAAGAGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193031902 Original CRISPR CCCTTGCCAGAAAGAGAAAT TGG Intergenic
No off target data available for this crispr