ID: 1193032768

View in Genome Browser
Species Human (GRCh38)
Location X:76917486-76917508
Sequence TGGCTGCTATTGATGATACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193032768_1193032771 1 Left 1193032768 X:76917486-76917508 CCTTGTATCATCAATAGCAGCCA No data
Right 1193032771 X:76917510-76917532 TATTGAATATTTAGTAGGTGAGG No data
1193032768_1193032769 -4 Left 1193032768 X:76917486-76917508 CCTTGTATCATCAATAGCAGCCA No data
Right 1193032769 X:76917505-76917527 GCCAATATTGAATATTTAGTAGG No data
1193032768_1193032775 17 Left 1193032768 X:76917486-76917508 CCTTGTATCATCAATAGCAGCCA No data
Right 1193032775 X:76917526-76917548 GGTGAGGCACACAGAGGGGAAGG No data
1193032768_1193032773 12 Left 1193032768 X:76917486-76917508 CCTTGTATCATCAATAGCAGCCA No data
Right 1193032773 X:76917521-76917543 TAGTAGGTGAGGCACACAGAGGG No data
1193032768_1193032772 11 Left 1193032768 X:76917486-76917508 CCTTGTATCATCAATAGCAGCCA No data
Right 1193032772 X:76917520-76917542 TTAGTAGGTGAGGCACACAGAGG No data
1193032768_1193032774 13 Left 1193032768 X:76917486-76917508 CCTTGTATCATCAATAGCAGCCA No data
Right 1193032774 X:76917522-76917544 AGTAGGTGAGGCACACAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193032768 Original CRISPR TGGCTGCTATTGATGATACA AGG (reversed) Intergenic
No off target data available for this crispr