ID: 1193032771

View in Genome Browser
Species Human (GRCh38)
Location X:76917510-76917532
Sequence TATTGAATATTTAGTAGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193032766_1193032771 22 Left 1193032766 X:76917465-76917487 CCACCTTGCATCATTCTTTATCC No data
Right 1193032771 X:76917510-76917532 TATTGAATATTTAGTAGGTGAGG No data
1193032768_1193032771 1 Left 1193032768 X:76917486-76917508 CCTTGTATCATCAATAGCAGCCA No data
Right 1193032771 X:76917510-76917532 TATTGAATATTTAGTAGGTGAGG No data
1193032767_1193032771 19 Left 1193032767 X:76917468-76917490 CCTTGCATCATTCTTTATCCTTG No data
Right 1193032771 X:76917510-76917532 TATTGAATATTTAGTAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193032771 Original CRISPR TATTGAATATTTAGTAGGTG AGG Intergenic
No off target data available for this crispr