ID: 1193032773 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:76917521-76917543 |
| Sequence | TAGTAGGTGAGGCACACAGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1193032767_1193032773 | 30 | Left | 1193032767 | X:76917468-76917490 | CCTTGCATCATTCTTTATCCTTG | No data | ||
| Right | 1193032773 | X:76917521-76917543 | TAGTAGGTGAGGCACACAGAGGG | No data | ||||
| 1193032768_1193032773 | 12 | Left | 1193032768 | X:76917486-76917508 | CCTTGTATCATCAATAGCAGCCA | No data | ||
| Right | 1193032773 | X:76917521-76917543 | TAGTAGGTGAGGCACACAGAGGG | No data | ||||
| 1193032770_1193032773 | -8 | Left | 1193032770 | X:76917506-76917528 | CCAATATTGAATATTTAGTAGGT | No data | ||
| Right | 1193032773 | X:76917521-76917543 | TAGTAGGTGAGGCACACAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1193032773 | Original CRISPR | TAGTAGGTGAGGCACACAGA GGG | Intergenic | ||
| No off target data available for this crispr | |||||