ID: 1193032773

View in Genome Browser
Species Human (GRCh38)
Location X:76917521-76917543
Sequence TAGTAGGTGAGGCACACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193032767_1193032773 30 Left 1193032767 X:76917468-76917490 CCTTGCATCATTCTTTATCCTTG No data
Right 1193032773 X:76917521-76917543 TAGTAGGTGAGGCACACAGAGGG No data
1193032768_1193032773 12 Left 1193032768 X:76917486-76917508 CCTTGTATCATCAATAGCAGCCA No data
Right 1193032773 X:76917521-76917543 TAGTAGGTGAGGCACACAGAGGG No data
1193032770_1193032773 -8 Left 1193032770 X:76917506-76917528 CCAATATTGAATATTTAGTAGGT No data
Right 1193032773 X:76917521-76917543 TAGTAGGTGAGGCACACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193032773 Original CRISPR TAGTAGGTGAGGCACACAGA GGG Intergenic
No off target data available for this crispr