ID: 1193033526

View in Genome Browser
Species Human (GRCh38)
Location X:76924838-76924860
Sequence GCAGCCAGGAAGCTTAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193033523_1193033526 -8 Left 1193033523 X:76924823-76924845 CCTTAGGTAAACAAAGCAGCCAG No data
Right 1193033526 X:76924838-76924860 GCAGCCAGGAAGCTTAAACTGGG No data
1193033518_1193033526 11 Left 1193033518 X:76924804-76924826 CCCGCCATTGCCAAGGCTTCCTT No data
Right 1193033526 X:76924838-76924860 GCAGCCAGGAAGCTTAAACTGGG No data
1193033519_1193033526 10 Left 1193033519 X:76924805-76924827 CCGCCATTGCCAAGGCTTCCTTA No data
Right 1193033526 X:76924838-76924860 GCAGCCAGGAAGCTTAAACTGGG No data
1193033522_1193033526 1 Left 1193033522 X:76924814-76924836 CCAAGGCTTCCTTAGGTAAACAA 0: 32
1: 2007
2: 1074
3: 652
4: 378
Right 1193033526 X:76924838-76924860 GCAGCCAGGAAGCTTAAACTGGG No data
1193033521_1193033526 7 Left 1193033521 X:76924808-76924830 CCATTGCCAAGGCTTCCTTAGGT No data
Right 1193033526 X:76924838-76924860 GCAGCCAGGAAGCTTAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193033526 Original CRISPR GCAGCCAGGAAGCTTAAACT GGG Intergenic
No off target data available for this crispr