ID: 1193038215

View in Genome Browser
Species Human (GRCh38)
Location X:76976579-76976601
Sequence CAGAACATGGAGAAACAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193038213_1193038215 2 Left 1193038213 X:76976554-76976576 CCAAAAAAAGAAAAGAAGCACAT No data
Right 1193038215 X:76976579-76976601 CAGAACATGGAGAAACAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193038215 Original CRISPR CAGAACATGGAGAAACAAAC TGG Intergenic
No off target data available for this crispr