ID: 1193040540

View in Genome Browser
Species Human (GRCh38)
Location X:76999266-76999288
Sequence CAGGGTAAGCAGAAGTAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193040540_1193040551 24 Left 1193040540 X:76999266-76999288 CCACCCTACTTCTGCTTACCCTG No data
Right 1193040551 X:76999313-76999335 CAGTTCCAATGAGATGAACCGGG 0: 17
1: 427
2: 918
3: 890
4: 1086
1193040540_1193040550 23 Left 1193040540 X:76999266-76999288 CCACCCTACTTCTGCTTACCCTG No data
Right 1193040550 X:76999312-76999334 CCAGTTCCAATGAGATGAACCGG 0: 12
1: 168
2: 424
3: 391
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193040540 Original CRISPR CAGGGTAAGCAGAAGTAGGG TGG (reversed) Intergenic
No off target data available for this crispr