ID: 1193040551

View in Genome Browser
Species Human (GRCh38)
Location X:76999313-76999335
Sequence CAGTTCCAATGAGATGAACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3338
Summary {0: 17, 1: 427, 2: 918, 3: 890, 4: 1086}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193040542_1193040551 20 Left 1193040542 X:76999270-76999292 CCTACTTCTGCTTACCCTGTGTG No data
Right 1193040551 X:76999313-76999335 CAGTTCCAATGAGATGAACCGGG 0: 17
1: 427
2: 918
3: 890
4: 1086
1193040539_1193040551 25 Left 1193040539 X:76999265-76999287 CCCACCCTACTTCTGCTTACCCT No data
Right 1193040551 X:76999313-76999335 CAGTTCCAATGAGATGAACCGGG 0: 17
1: 427
2: 918
3: 890
4: 1086
1193040546_1193040551 -10 Left 1193040546 X:76999300-76999322 CCCACTACCTAACCAGTTCCAAT No data
Right 1193040551 X:76999313-76999335 CAGTTCCAATGAGATGAACCGGG 0: 17
1: 427
2: 918
3: 890
4: 1086
1193040540_1193040551 24 Left 1193040540 X:76999266-76999288 CCACCCTACTTCTGCTTACCCTG No data
Right 1193040551 X:76999313-76999335 CAGTTCCAATGAGATGAACCGGG 0: 17
1: 427
2: 918
3: 890
4: 1086
1193040544_1193040551 6 Left 1193040544 X:76999284-76999306 CCCTGTGTGGACTGCACCCACTA No data
Right 1193040551 X:76999313-76999335 CAGTTCCAATGAGATGAACCGGG 0: 17
1: 427
2: 918
3: 890
4: 1086
1193040545_1193040551 5 Left 1193040545 X:76999285-76999307 CCTGTGTGGACTGCACCCACTAC No data
Right 1193040551 X:76999313-76999335 CAGTTCCAATGAGATGAACCGGG 0: 17
1: 427
2: 918
3: 890
4: 1086
1193040541_1193040551 21 Left 1193040541 X:76999269-76999291 CCCTACTTCTGCTTACCCTGTGT No data
Right 1193040551 X:76999313-76999335 CAGTTCCAATGAGATGAACCGGG 0: 17
1: 427
2: 918
3: 890
4: 1086
1193040538_1193040551 26 Left 1193040538 X:76999264-76999286 CCCCACCCTACTTCTGCTTACCC No data
Right 1193040551 X:76999313-76999335 CAGTTCCAATGAGATGAACCGGG 0: 17
1: 427
2: 918
3: 890
4: 1086

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193040551 Original CRISPR CAGTTCCAATGAGATGAACC GGG Intergenic
Too many off-targets to display for this crispr