ID: 1193040746

View in Genome Browser
Species Human (GRCh38)
Location X:77001186-77001208
Sequence TCTGCCCTTAGCTCCCATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193040746_1193040750 -7 Left 1193040746 X:77001186-77001208 CCTTCATGGGAGCTAAGGGCAGA No data
Right 1193040750 X:77001202-77001224 GGGCAGAGGAAAGAAGAATGGGG No data
1193040746_1193040749 -8 Left 1193040746 X:77001186-77001208 CCTTCATGGGAGCTAAGGGCAGA No data
Right 1193040749 X:77001201-77001223 AGGGCAGAGGAAAGAAGAATGGG No data
1193040746_1193040748 -9 Left 1193040746 X:77001186-77001208 CCTTCATGGGAGCTAAGGGCAGA No data
Right 1193040748 X:77001200-77001222 AAGGGCAGAGGAAAGAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193040746 Original CRISPR TCTGCCCTTAGCTCCCATGA AGG (reversed) Intergenic
No off target data available for this crispr