ID: 1193043882

View in Genome Browser
Species Human (GRCh38)
Location X:77032069-77032091
Sequence GAGGGTGAGCAGAAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193043882_1193043892 24 Left 1193043882 X:77032069-77032091 CCATCCTGCTTCTGCTCACCCTC No data
Right 1193043892 X:77032116-77032138 CAATCCCAGTGAGATGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193043882 Original CRISPR GAGGGTGAGCAGAAGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr