ID: 1193052153

View in Genome Browser
Species Human (GRCh38)
Location X:77112843-77112865
Sequence CATAATCCTGTATTTCTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 11093
Summary {0: 2, 1: 58, 2: 547, 3: 6927, 4: 3559}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193052153_1193052155 23 Left 1193052153 X:77112843-77112865 CCTCCAAGAAATACAGGATTATG 0: 2
1: 58
2: 547
3: 6927
4: 3559
Right 1193052155 X:77112889-77112911 ATTGATGTACTTGAAAGAGATGG No data
1193052153_1193052157 25 Left 1193052153 X:77112843-77112865 CCTCCAAGAAATACAGGATTATG 0: 2
1: 58
2: 547
3: 6927
4: 3559
Right 1193052157 X:77112891-77112913 TGATGTACTTGAAAGAGATGGGG No data
1193052153_1193052156 24 Left 1193052153 X:77112843-77112865 CCTCCAAGAAATACAGGATTATG 0: 2
1: 58
2: 547
3: 6927
4: 3559
Right 1193052156 X:77112890-77112912 TTGATGTACTTGAAAGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193052153 Original CRISPR CATAATCCTGTATTTCTTGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr