ID: 1193052535

View in Genome Browser
Species Human (GRCh38)
Location X:77116265-77116287
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193052535_1193052550 28 Left 1193052535 X:77116265-77116287 CCCACAATTGCTGCACTCTCCCT No data
Right 1193052550 X:77116316-77116338 ATAGATGCTCCTGGGGGGTGTGG No data
1193052535_1193052548 23 Left 1193052535 X:77116265-77116287 CCCACAATTGCTGCACTCTCCCT No data
Right 1193052548 X:77116311-77116333 GCCATATAGATGCTCCTGGGGGG No data
1193052535_1193052545 20 Left 1193052535 X:77116265-77116287 CCCACAATTGCTGCACTCTCCCT No data
Right 1193052545 X:77116308-77116330 CCTGCCATATAGATGCTCCTGGG No data
1193052535_1193052547 22 Left 1193052535 X:77116265-77116287 CCCACAATTGCTGCACTCTCCCT No data
Right 1193052547 X:77116310-77116332 TGCCATATAGATGCTCCTGGGGG No data
1193052535_1193052551 29 Left 1193052535 X:77116265-77116287 CCCACAATTGCTGCACTCTCCCT No data
Right 1193052551 X:77116317-77116339 TAGATGCTCCTGGGGGGTGTGGG No data
1193052535_1193052546 21 Left 1193052535 X:77116265-77116287 CCCACAATTGCTGCACTCTCCCT No data
Right 1193052546 X:77116309-77116331 CTGCCATATAGATGCTCCTGGGG No data
1193052535_1193052543 19 Left 1193052535 X:77116265-77116287 CCCACAATTGCTGCACTCTCCCT No data
Right 1193052543 X:77116307-77116329 TCCTGCCATATAGATGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193052535 Original CRISPR AGGGAGAGTGCAGCAATTGT GGG (reversed) Intergenic
No off target data available for this crispr