ID: 1193052536

View in Genome Browser
Species Human (GRCh38)
Location X:77116266-77116288
Sequence GAGGGAGAGTGCAGCAATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193052536_1193052551 28 Left 1193052536 X:77116266-77116288 CCACAATTGCTGCACTCTCCCTC No data
Right 1193052551 X:77116317-77116339 TAGATGCTCCTGGGGGGTGTGGG No data
1193052536_1193052543 18 Left 1193052536 X:77116266-77116288 CCACAATTGCTGCACTCTCCCTC No data
Right 1193052543 X:77116307-77116329 TCCTGCCATATAGATGCTCCTGG No data
1193052536_1193052547 21 Left 1193052536 X:77116266-77116288 CCACAATTGCTGCACTCTCCCTC No data
Right 1193052547 X:77116310-77116332 TGCCATATAGATGCTCCTGGGGG No data
1193052536_1193052550 27 Left 1193052536 X:77116266-77116288 CCACAATTGCTGCACTCTCCCTC No data
Right 1193052550 X:77116316-77116338 ATAGATGCTCCTGGGGGGTGTGG No data
1193052536_1193052546 20 Left 1193052536 X:77116266-77116288 CCACAATTGCTGCACTCTCCCTC No data
Right 1193052546 X:77116309-77116331 CTGCCATATAGATGCTCCTGGGG No data
1193052536_1193052548 22 Left 1193052536 X:77116266-77116288 CCACAATTGCTGCACTCTCCCTC No data
Right 1193052548 X:77116311-77116333 GCCATATAGATGCTCCTGGGGGG No data
1193052536_1193052545 19 Left 1193052536 X:77116266-77116288 CCACAATTGCTGCACTCTCCCTC No data
Right 1193052545 X:77116308-77116330 CCTGCCATATAGATGCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193052536 Original CRISPR GAGGGAGAGTGCAGCAATTG TGG (reversed) Intergenic
No off target data available for this crispr