ID: 1193052538

View in Genome Browser
Species Human (GRCh38)
Location X:77116285-77116307
Sequence ATAATCTGTGCACTTGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193052538_1193052546 1 Left 1193052538 X:77116285-77116307 CCTCCCCCAAGTGCACAGATTAT No data
Right 1193052546 X:77116309-77116331 CTGCCATATAGATGCTCCTGGGG No data
1193052538_1193052550 8 Left 1193052538 X:77116285-77116307 CCTCCCCCAAGTGCACAGATTAT No data
Right 1193052550 X:77116316-77116338 ATAGATGCTCCTGGGGGGTGTGG No data
1193052538_1193052545 0 Left 1193052538 X:77116285-77116307 CCTCCCCCAAGTGCACAGATTAT No data
Right 1193052545 X:77116308-77116330 CCTGCCATATAGATGCTCCTGGG No data
1193052538_1193052552 13 Left 1193052538 X:77116285-77116307 CCTCCCCCAAGTGCACAGATTAT No data
Right 1193052552 X:77116321-77116343 TGCTCCTGGGGGGTGTGGGATGG No data
1193052538_1193052556 23 Left 1193052538 X:77116285-77116307 CCTCCCCCAAGTGCACAGATTAT No data
Right 1193052556 X:77116331-77116353 GGGTGTGGGATGGGTGGTGTTGG No data
1193052538_1193052543 -1 Left 1193052538 X:77116285-77116307 CCTCCCCCAAGTGCACAGATTAT No data
Right 1193052543 X:77116307-77116329 TCCTGCCATATAGATGCTCCTGG No data
1193052538_1193052555 17 Left 1193052538 X:77116285-77116307 CCTCCCCCAAGTGCACAGATTAT No data
Right 1193052555 X:77116325-77116347 CCTGGGGGGTGTGGGATGGGTGG No data
1193052538_1193052551 9 Left 1193052538 X:77116285-77116307 CCTCCCCCAAGTGCACAGATTAT No data
Right 1193052551 X:77116317-77116339 TAGATGCTCCTGGGGGGTGTGGG No data
1193052538_1193052553 14 Left 1193052538 X:77116285-77116307 CCTCCCCCAAGTGCACAGATTAT No data
Right 1193052553 X:77116322-77116344 GCTCCTGGGGGGTGTGGGATGGG No data
1193052538_1193052548 3 Left 1193052538 X:77116285-77116307 CCTCCCCCAAGTGCACAGATTAT No data
Right 1193052548 X:77116311-77116333 GCCATATAGATGCTCCTGGGGGG No data
1193052538_1193052547 2 Left 1193052538 X:77116285-77116307 CCTCCCCCAAGTGCACAGATTAT No data
Right 1193052547 X:77116310-77116332 TGCCATATAGATGCTCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193052538 Original CRISPR ATAATCTGTGCACTTGGGGG AGG (reversed) Intergenic
No off target data available for this crispr