ID: 1193052546

View in Genome Browser
Species Human (GRCh38)
Location X:77116309-77116331
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193052540_1193052546 -3 Left 1193052540 X:77116289-77116311 CCCCAAGTGCACAGATTATCCTG No data
Right 1193052546 X:77116309-77116331 CTGCCATATAGATGCTCCTGGGG No data
1193052538_1193052546 1 Left 1193052538 X:77116285-77116307 CCTCCCCCAAGTGCACAGATTAT No data
Right 1193052546 X:77116309-77116331 CTGCCATATAGATGCTCCTGGGG No data
1193052541_1193052546 -4 Left 1193052541 X:77116290-77116312 CCCAAGTGCACAGATTATCCTGC No data
Right 1193052546 X:77116309-77116331 CTGCCATATAGATGCTCCTGGGG No data
1193052539_1193052546 -2 Left 1193052539 X:77116288-77116310 CCCCCAAGTGCACAGATTATCCT No data
Right 1193052546 X:77116309-77116331 CTGCCATATAGATGCTCCTGGGG No data
1193052542_1193052546 -5 Left 1193052542 X:77116291-77116313 CCAAGTGCACAGATTATCCTGCC No data
Right 1193052546 X:77116309-77116331 CTGCCATATAGATGCTCCTGGGG No data
1193052537_1193052546 2 Left 1193052537 X:77116284-77116306 CCCTCCCCCAAGTGCACAGATTA No data
Right 1193052546 X:77116309-77116331 CTGCCATATAGATGCTCCTGGGG No data
1193052536_1193052546 20 Left 1193052536 X:77116266-77116288 CCACAATTGCTGCACTCTCCCTC No data
Right 1193052546 X:77116309-77116331 CTGCCATATAGATGCTCCTGGGG No data
1193052535_1193052546 21 Left 1193052535 X:77116265-77116287 CCCACAATTGCTGCACTCTCCCT No data
Right 1193052546 X:77116309-77116331 CTGCCATATAGATGCTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193052546 Original CRISPR CTGCCATATAGATGCTCCTG GGG Intergenic
No off target data available for this crispr