ID: 1193053487

View in Genome Browser
Species Human (GRCh38)
Location X:77125736-77125758
Sequence AGTTTTCTGCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193053487_1193053493 25 Left 1193053487 X:77125736-77125758 CCTGCCATCTTCTGCAGAAAACT No data
Right 1193053493 X:77125784-77125806 GGCCTGTTACTGGGCTTTGATGG No data
1193053487_1193053489 4 Left 1193053487 X:77125736-77125758 CCTGCCATCTTCTGCAGAAAACT No data
Right 1193053489 X:77125763-77125785 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293
1193053487_1193053492 16 Left 1193053487 X:77125736-77125758 CCTGCCATCTTCTGCAGAAAACT No data
Right 1193053492 X:77125775-77125797 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215
1193053487_1193053491 15 Left 1193053487 X:77125736-77125758 CCTGCCATCTTCTGCAGAAAACT No data
Right 1193053491 X:77125774-77125796 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193053487 Original CRISPR AGTTTTCTGCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr