ID: 1193053493

View in Genome Browser
Species Human (GRCh38)
Location X:77125784-77125806
Sequence GGCCTGTTACTGGGCTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193053487_1193053493 25 Left 1193053487 X:77125736-77125758 CCTGCCATCTTCTGCAGAAAACT No data
Right 1193053493 X:77125784-77125806 GGCCTGTTACTGGGCTTTGATGG No data
1193053490_1193053493 -3 Left 1193053490 X:77125764-77125786 CCTTTTGAGAGACAGCTCTTGGC 0: 173
1: 182
2: 165
3: 95
4: 236
Right 1193053493 X:77125784-77125806 GGCCTGTTACTGGGCTTTGATGG No data
1193053486_1193053493 26 Left 1193053486 X:77125735-77125757 CCCTGCCATCTTCTGCAGAAAAC No data
Right 1193053493 X:77125784-77125806 GGCCTGTTACTGGGCTTTGATGG No data
1193053488_1193053493 21 Left 1193053488 X:77125740-77125762 CCATCTTCTGCAGAAAACTACTC No data
Right 1193053493 X:77125784-77125806 GGCCTGTTACTGGGCTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193053493 Original CRISPR GGCCTGTTACTGGGCTTTGA TGG Intergenic
No off target data available for this crispr