ID: 1193053811

View in Genome Browser
Species Human (GRCh38)
Location X:77128278-77128300
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193053808_1193053811 10 Left 1193053808 X:77128245-77128267 CCCACTTTTAACCTGGTGGGCAC No data
Right 1193053811 X:77128278-77128300 GCTGCCAGCAAATTTAAAGCAGG No data
1193053809_1193053811 9 Left 1193053809 X:77128246-77128268 CCACTTTTAACCTGGTGGGCACA No data
Right 1193053811 X:77128278-77128300 GCTGCCAGCAAATTTAAAGCAGG No data
1193053810_1193053811 -1 Left 1193053810 X:77128256-77128278 CCTGGTGGGCACAATCTCATCAG No data
Right 1193053811 X:77128278-77128300 GCTGCCAGCAAATTTAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193053811 Original CRISPR GCTGCCAGCAAATTTAAAGC AGG Intergenic
No off target data available for this crispr