ID: 1193057097

View in Genome Browser
Species Human (GRCh38)
Location X:77164454-77164476
Sequence GGGAAGGTAAATGTCTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193057097_1193057102 15 Left 1193057097 X:77164454-77164476 CCTGAAAAGACATTTACCTTCCC No data
Right 1193057102 X:77164492-77164514 TCATTTACAATAGCCAGGTATGG No data
1193057097_1193057101 10 Left 1193057097 X:77164454-77164476 CCTGAAAAGACATTTACCTTCCC No data
Right 1193057101 X:77164487-77164509 CAGTTTCATTTACAATAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193057097 Original CRISPR GGGAAGGTAAATGTCTTTTC AGG (reversed) Intergenic