ID: 1193057101

View in Genome Browser
Species Human (GRCh38)
Location X:77164487-77164509
Sequence CAGTTTCATTTACAATAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193057098_1193057101 -6 Left 1193057098 X:77164470-77164492 CCTTCCCATGTTCACTGCAGTTT No data
Right 1193057101 X:77164487-77164509 CAGTTTCATTTACAATAGCCAGG No data
1193057099_1193057101 -10 Left 1193057099 X:77164474-77164496 CCCATGTTCACTGCAGTTTCATT No data
Right 1193057101 X:77164487-77164509 CAGTTTCATTTACAATAGCCAGG No data
1193057097_1193057101 10 Left 1193057097 X:77164454-77164476 CCTGAAAAGACATTTACCTTCCC No data
Right 1193057101 X:77164487-77164509 CAGTTTCATTTACAATAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193057101 Original CRISPR CAGTTTCATTTACAATAGCC AGG Intergenic