ID: 1193058362

View in Genome Browser
Species Human (GRCh38)
Location X:77178308-77178330
Sequence CCCTTTAGTGATTAGTAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193058362_1193058365 26 Left 1193058362 X:77178308-77178330 CCTTTCTACTAATCACTAAAGGG No data
Right 1193058365 X:77178357-77178379 ATGTCAAGAAAAAACTTCATAGG No data
1193058362_1193058364 -8 Left 1193058362 X:77178308-77178330 CCTTTCTACTAATCACTAAAGGG No data
Right 1193058364 X:77178323-77178345 CTAAAGGGCTTAAAAATTAGTGG No data
1193058362_1193058366 27 Left 1193058362 X:77178308-77178330 CCTTTCTACTAATCACTAAAGGG No data
Right 1193058366 X:77178358-77178380 TGTCAAGAAAAAACTTCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193058362 Original CRISPR CCCTTTAGTGATTAGTAGAA AGG (reversed) Intergenic
No off target data available for this crispr