ID: 1193062933 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:77225305-77225327 |
| Sequence | GCACATATACTTAAGGTAAA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1193062930_1193062933 | -7 | Left | 1193062930 | X:77225289-77225311 | CCTAACACATAAAGATGCACATA | No data | ||
| Right | 1193062933 | X:77225305-77225327 | GCACATATACTTAAGGTAAAGGG | No data | ||||
| 1193062928_1193062933 | 26 | Left | 1193062928 | X:77225256-77225278 | CCAATCAACTATCTGTTGCTTTC | No data | ||
| Right | 1193062933 | X:77225305-77225327 | GCACATATACTTAAGGTAAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1193062933 | Original CRISPR | GCACATATACTTAAGGTAAA GGG | Intergenic | ||
| No off target data available for this crispr | |||||