ID: 1193062933

View in Genome Browser
Species Human (GRCh38)
Location X:77225305-77225327
Sequence GCACATATACTTAAGGTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193062930_1193062933 -7 Left 1193062930 X:77225289-77225311 CCTAACACATAAAGATGCACATA No data
Right 1193062933 X:77225305-77225327 GCACATATACTTAAGGTAAAGGG No data
1193062928_1193062933 26 Left 1193062928 X:77225256-77225278 CCAATCAACTATCTGTTGCTTTC No data
Right 1193062933 X:77225305-77225327 GCACATATACTTAAGGTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193062933 Original CRISPR GCACATATACTTAAGGTAAA GGG Intergenic
No off target data available for this crispr