ID: 1193070033

View in Genome Browser
Species Human (GRCh38)
Location X:77297307-77297329
Sequence CCTTTCAATGGGAAGATCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193070025_1193070033 21 Left 1193070025 X:77297263-77297285 CCTTTTTGGCATCTGACTAGCTC No data
Right 1193070033 X:77297307-77297329 CCTTTCAATGGGAAGATCTGGGG No data
1193070026_1193070033 -1 Left 1193070026 X:77297285-77297307 CCTGAGAGCCAGAAGTTGTTTGC No data
Right 1193070033 X:77297307-77297329 CCTTTCAATGGGAAGATCTGGGG No data
1193070027_1193070033 -9 Left 1193070027 X:77297293-77297315 CCAGAAGTTGTTTGCCTTTCAAT No data
Right 1193070033 X:77297307-77297329 CCTTTCAATGGGAAGATCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193070033 Original CRISPR CCTTTCAATGGGAAGATCTG GGG Intergenic
No off target data available for this crispr