ID: 1193070820

View in Genome Browser
Species Human (GRCh38)
Location X:77303778-77303800
Sequence TCATCAACTGCCACTCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193070814_1193070820 28 Left 1193070814 X:77303727-77303749 CCAATACTGGTGCCCACGTAAGT No data
Right 1193070820 X:77303778-77303800 TCATCAACTGCCACTCTCAAGGG No data
1193070816_1193070820 15 Left 1193070816 X:77303740-77303762 CCACGTAAGTTGTCTAGTGAACT No data
Right 1193070820 X:77303778-77303800 TCATCAACTGCCACTCTCAAGGG No data
1193070815_1193070820 16 Left 1193070815 X:77303739-77303761 CCCACGTAAGTTGTCTAGTGAAC No data
Right 1193070820 X:77303778-77303800 TCATCAACTGCCACTCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193070820 Original CRISPR TCATCAACTGCCACTCTCAA GGG Intergenic
No off target data available for this crispr