ID: 1193071559

View in Genome Browser
Species Human (GRCh38)
Location X:77311235-77311257
Sequence ATGTTACCCTTCAATAATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193071557_1193071559 -3 Left 1193071557 X:77311215-77311237 CCAGCCAGGAATACATAGCAATG No data
Right 1193071559 X:77311235-77311257 ATGTTACCCTTCAATAATGTAGG No data
1193071558_1193071559 -7 Left 1193071558 X:77311219-77311241 CCAGGAATACATAGCAATGTTAC No data
Right 1193071559 X:77311235-77311257 ATGTTACCCTTCAATAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193071559 Original CRISPR ATGTTACCCTTCAATAATGT AGG Intergenic
No off target data available for this crispr