ID: 1193077720

View in Genome Browser
Species Human (GRCh38)
Location X:77373275-77373297
Sequence CTGTCGACACATGTACAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193077715_1193077720 12 Left 1193077715 X:77373240-77373262 CCCCTCAGTGTGTTTAATTTCTC No data
Right 1193077720 X:77373275-77373297 CTGTCGACACATGTACAGGCAGG No data
1193077716_1193077720 11 Left 1193077716 X:77373241-77373263 CCCTCAGTGTGTTTAATTTCTCT No data
Right 1193077720 X:77373275-77373297 CTGTCGACACATGTACAGGCAGG No data
1193077717_1193077720 10 Left 1193077717 X:77373242-77373264 CCTCAGTGTGTTTAATTTCTCTA No data
Right 1193077720 X:77373275-77373297 CTGTCGACACATGTACAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193077720 Original CRISPR CTGTCGACACATGTACAGGC AGG Intergenic
No off target data available for this crispr