ID: 1193083558

View in Genome Browser
Species Human (GRCh38)
Location X:77428305-77428327
Sequence CAGAGCCTGGGCCAGGTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193083558_1193083568 15 Left 1193083558 X:77428305-77428327 CCAGATACCTGGCCCAGGCTCTG No data
Right 1193083568 X:77428343-77428365 CACTGGTTTGAAGGAATTGCTGG No data
1193083558_1193083566 6 Left 1193083558 X:77428305-77428327 CCAGATACCTGGCCCAGGCTCTG No data
Right 1193083566 X:77428334-77428356 CTGGACTTCCACTGGTTTGAAGG No data
1193083558_1193083569 16 Left 1193083558 X:77428305-77428327 CCAGATACCTGGCCCAGGCTCTG No data
Right 1193083569 X:77428344-77428366 ACTGGTTTGAAGGAATTGCTGGG No data
1193083558_1193083564 -2 Left 1193083558 X:77428305-77428327 CCAGATACCTGGCCCAGGCTCTG No data
Right 1193083564 X:77428326-77428348 TGGAACCTCTGGACTTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193083558 Original CRISPR CAGAGCCTGGGCCAGGTATC TGG (reversed) Intergenic
No off target data available for this crispr