ID: 1193084447

View in Genome Browser
Species Human (GRCh38)
Location X:77436851-77436873
Sequence CTTTAAAAGCAGTTGCTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193084445_1193084447 10 Left 1193084445 X:77436818-77436840 CCCTTGGGTAAACTATGAGATTA No data
Right 1193084447 X:77436851-77436873 CTTTAAAAGCAGTTGCTTTATGG No data
1193084444_1193084447 17 Left 1193084444 X:77436811-77436833 CCACAATCCCTTGGGTAAACTAT No data
Right 1193084447 X:77436851-77436873 CTTTAAAAGCAGTTGCTTTATGG No data
1193084446_1193084447 9 Left 1193084446 X:77436819-77436841 CCTTGGGTAAACTATGAGATTAC No data
Right 1193084447 X:77436851-77436873 CTTTAAAAGCAGTTGCTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193084447 Original CRISPR CTTTAAAAGCAGTTGCTTTA TGG Intergenic
No off target data available for this crispr