ID: 1193085271

View in Genome Browser
Species Human (GRCh38)
Location X:77443314-77443336
Sequence CAAAGAAAACAGAAGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193085267_1193085271 26 Left 1193085267 X:77443265-77443287 CCAGAGATGGAGTGTTCAACCAC No data
Right 1193085271 X:77443314-77443336 CAAAGAAAACAGAAGGAGAGAGG No data
1193085268_1193085271 7 Left 1193085268 X:77443284-77443306 CCACTACACTATACTGCTTTCCA No data
Right 1193085271 X:77443314-77443336 CAAAGAAAACAGAAGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193085271 Original CRISPR CAAAGAAAACAGAAGGAGAG AGG Intergenic
No off target data available for this crispr