ID: 1193087473

View in Genome Browser
Species Human (GRCh38)
Location X:77459817-77459839
Sequence ACTCTTGGTGTTGAACTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193087470_1193087473 -2 Left 1193087470 X:77459796-77459818 CCCAGGACACAGGAGGAGCTCAC No data
Right 1193087473 X:77459817-77459839 ACTCTTGGTGTTGAACTTTGAGG No data
1193087471_1193087473 -3 Left 1193087471 X:77459797-77459819 CCAGGACACAGGAGGAGCTCACT No data
Right 1193087473 X:77459817-77459839 ACTCTTGGTGTTGAACTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193087473 Original CRISPR ACTCTTGGTGTTGAACTTTG AGG Intergenic
No off target data available for this crispr