ID: 1193093554

View in Genome Browser
Species Human (GRCh38)
Location X:77521804-77521826
Sequence GTAAATTAAATAGGAAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 486
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 446}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193093554_1193093556 17 Left 1193093554 X:77521804-77521826 CCAGTCTTTCCTATTTAATTTAC 0: 1
1: 0
2: 3
3: 36
4: 446
Right 1193093556 X:77521844-77521866 AATCATTTATTTCATAATATTGG 0: 1
1: 1
2: 7
3: 68
4: 678
1193093554_1193093557 18 Left 1193093554 X:77521804-77521826 CCAGTCTTTCCTATTTAATTTAC 0: 1
1: 0
2: 3
3: 36
4: 446
Right 1193093557 X:77521845-77521867 ATCATTTATTTCATAATATTGGG 0: 1
1: 0
2: 8
3: 71
4: 742

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193093554 Original CRISPR GTAAATTAAATAGGAAAGAC TGG (reversed) Intronic
901282288 1:8047895-8047917 GGAAATTAAATAGGGGATACAGG - Intergenic
903073703 1:20744778-20744800 GTAAATTTTATAGGAAAAAAGGG - Exonic
906788406 1:48636877-48636899 GTAAATTAAGGAGGAGAGACTGG + Intronic
908589681 1:65616959-65616981 GGACATAAAATAAGAAAGACAGG - Intronic
908822007 1:68097722-68097744 GCAAATTAAATAAAAAAGACAGG - Intergenic
909084942 1:71159345-71159367 ATAAATTGGATAGAAAAGACAGG + Intergenic
909220259 1:72950171-72950193 ATAAATTAAACAACAAAGACTGG - Intergenic
909317208 1:74238375-74238397 GTAAATTAAATACTAAGTACAGG + Intronic
909714232 1:78688314-78688336 GGAAATTAAACAAGAAAGGCAGG + Intergenic
909769115 1:79398065-79398087 CTAAATAGAAAAGGAAAGACGGG + Intergenic
909850056 1:80450314-80450336 ATAAATTAAATAGTAAAAACTGG - Intergenic
910032976 1:82753741-82753763 GTGATGTAAATAGGAAATACTGG - Intergenic
910938945 1:92512157-92512179 CTAAATGATATAGGAAAAACTGG + Exonic
910959829 1:92750187-92750209 ATAAATGAAATAGGAAAAAAAGG + Intronic
911236475 1:95417791-95417813 GTAATTTATAAAGGAAAGAGAGG + Intergenic
912120763 1:106469039-106469061 GTAAATTAACAAGAAAAGATTGG + Intergenic
916011749 1:160712427-160712449 GTAATTTATAAAGGAAAGAGAGG + Intergenic
916871498 1:168919394-168919416 GTAAATTGAATAGGAAACTGAGG - Intergenic
917267860 1:173240997-173241019 GTAAATTCAATAGAAAAAATAGG - Intergenic
917373647 1:174324400-174324422 GCAAATGAGATAGGAAACACAGG + Intronic
918055761 1:181020763-181020785 CAAAATTAAATAGAAATGACAGG - Intronic
918506338 1:185258014-185258036 GTATGATAAAGAGGAAAGACAGG - Intronic
918584417 1:186169257-186169279 GTAAATTAAATTGGGAAGTATGG - Intronic
918700838 1:187604902-187604924 GGAAATTCAATGGGAAAAACTGG - Intergenic
918891716 1:190280727-190280749 TAAAATTGAATAGGAAAGCCAGG - Intronic
918999175 1:191806544-191806566 TAAAATTAACTAGGAAAAACTGG - Intergenic
919212556 1:194507483-194507505 GTAAATTTAAAATGAAAGATTGG + Intergenic
919235404 1:194835026-194835048 GTGAATTATTTAGGAAAAACTGG + Intergenic
919300939 1:195764080-195764102 GAAAATGTGATAGGAAAGACTGG - Intergenic
920548198 1:206836289-206836311 ATAAATTAAATAGGAAAAGCAGG - Intronic
920649818 1:207828519-207828541 GGAAATTAAAAAGGAAGGGCGGG + Intergenic
921338238 1:214109368-214109390 CTAAATAAAATAGGAAGGTCAGG + Intergenic
921635440 1:217487074-217487096 GAAAATAAAATATGAAATACAGG - Intronic
923466443 1:234251211-234251233 GTAAAGGAAATAGCAAGGACTGG + Intronic
923997918 1:239517429-239517451 GTAAAATAAATGGGAAAGTGAGG - Intronic
924272857 1:242351619-242351641 GTAATTTATAAAGGAAAGAGAGG - Intronic
924312103 1:242754804-242754826 CTAAATAAAATGGGAAAGTCAGG - Intergenic
1064264965 10:13818615-13818637 TGAAATTATATAAGAAAGACAGG - Intronic
1064852168 10:19720912-19720934 GTGAGTTACATAGGAAACACAGG + Intronic
1065648872 10:27866408-27866430 GTAAATTCAAAAGCAAAAACAGG + Intronic
1065770090 10:29070095-29070117 CTACATAAGATAGGAAAGACAGG + Intergenic
1066060768 10:31721745-31721767 GTAACATTAATAGGAAATACAGG - Intergenic
1066177914 10:32928869-32928891 GTAATTTACTTAGGAAATACAGG + Intronic
1066323728 10:34332016-34332038 GGAAATAAAAAAGGAGAGACTGG + Intronic
1066711857 10:38245039-38245061 GTAATTTATAAAGGAAAGAGAGG + Intergenic
1067031820 10:42883253-42883275 TAAAATTAATTAGGAAAGAAGGG - Intergenic
1068008881 10:51422703-51422725 GAAACTTAAAAAGGAAAGGCAGG - Intronic
1068373918 10:56154742-56154764 GTAAAGCAAATAGGAAAGGGAGG - Intergenic
1069048125 10:63764475-63764497 GTAAAGAAGATAGGGAAGACAGG - Intergenic
1069053798 10:63822513-63822535 CTATATTAAATAAGAAAGAGAGG - Intergenic
1069263221 10:66426402-66426424 GTAAATTAAAAAAGAAAGCACGG - Intronic
1070051161 10:72891173-72891195 GTAATTTAAATAGGGGAGAGGGG - Intergenic
1071164567 10:82790107-82790129 TTAAATCAAATGGGAAAGAAAGG + Intronic
1072047780 10:91673890-91673912 TTAAATTAAAAAGTAAAAACAGG + Intergenic
1072071021 10:91917577-91917599 GAAAATTAATAAGGAAATACTGG - Intergenic
1072372628 10:94779845-94779867 GTAAATTAGATAGGGCACACTGG - Intronic
1072647504 10:97268511-97268533 GTAATTTACAAAGGAAAGAGAGG + Intronic
1072879328 10:99209091-99209113 GAAAATTAATAAGGAAAAACTGG + Intronic
1072886085 10:99275595-99275617 TTAAATTCAAAAGGAAAGAAGGG - Intergenic
1073525342 10:104176251-104176273 GTATATTAAATAAAACAGACTGG + Intronic
1073882053 10:107993657-107993679 GTAAATAAAATATGAAAAAATGG - Intergenic
1074444698 10:113511227-113511249 TTAAATTATATAGGAAAAAGAGG + Intergenic
1074502376 10:114038047-114038069 GTAACTTAAAGAAGAAAGAAAGG - Intergenic
1075803057 10:125164666-125164688 GGAAATGAAATAGGAAAGATAGG - Intergenic
1077723877 11:4654084-4654106 GAAAATTAAATAGGAAAAACAGG - Exonic
1077971752 11:7200480-7200502 AAAAATTTAATAGGAAAGACTGG + Intergenic
1078028744 11:7726315-7726337 ATAACTCAAATAGGAAACACAGG + Intergenic
1078626302 11:12962059-12962081 GAAAAGAAAATAGGAAAGAAGGG + Intergenic
1079419260 11:20270858-20270880 GCAAAGTAAATAGGTAAGTCGGG - Intergenic
1079670750 11:23167594-23167616 GTCAATTAAACAGAAAAGAGAGG - Intergenic
1081147909 11:39586076-39586098 GGAAATTAAAAAAAAAAGACGGG + Intergenic
1081551814 11:44120525-44120547 AAAAATTAAAAAGTAAAGACAGG + Intronic
1083089405 11:60184573-60184595 TTAAATTAAATAGCACAGAGAGG - Exonic
1085179457 11:74521240-74521262 CTAAATTAAGGAGGAAAGGCAGG + Intronic
1086356134 11:86001736-86001758 GTATATTAAAAAGGAAATTCTGG - Intronic
1087204695 11:95381712-95381734 CCATATTAAATAGAAAAGACTGG - Intergenic
1088287003 11:108199869-108199891 GAAAATGCTATAGGAAAGACTGG - Intronic
1089827931 11:121295773-121295795 GTAATTGAAATAGGGAATACTGG - Intronic
1090209117 11:124904877-124904899 GAAAATTAAAAAGGAAACATTGG - Intergenic
1090856271 11:130611591-130611613 GTAAACAAAATAGGAAATATTGG + Intergenic
1092646021 12:10572826-10572848 TTAAATGAAAAAGGAAAGAGGGG + Intergenic
1092722014 12:11450699-11450721 GTAAATTTAATCTGAAAGACTGG - Intronic
1092865673 12:12758607-12758629 GTTCATTCAATAGGAAAGGCAGG - Intronic
1092869712 12:12795469-12795491 GGAAACTAAATAAGAAAGGCTGG - Intronic
1092961877 12:13603715-13603737 GGGAATTAAATAGGAAAGTGGGG + Intronic
1093791825 12:23260456-23260478 GTTATTTAAAAAGGAAAAACAGG + Intergenic
1093804394 12:23414349-23414371 TTGAACTAAATAGGAAAAACCGG + Intergenic
1095539094 12:43287402-43287424 GAAAACTAATTAGGAAAGAAAGG - Intergenic
1095600349 12:44005988-44006010 GTAATTTATATAGGAAAAAAAGG - Intronic
1096633855 12:52946309-52946331 GTCAATTTAATTCGAAAGACGGG - Intronic
1097239531 12:57565599-57565621 TTAGATTAAATAAGAGAGACGGG - Intronic
1097496201 12:60339074-60339096 GTAAATTAAATAGGTAATATGGG + Intergenic
1097643864 12:62213097-62213119 GTAAATCCAAAAGAAAAGACAGG - Intronic
1097854483 12:64447755-64447777 GTAAATTAAATATTGAGGACGGG - Intronic
1098034596 12:66289075-66289097 GTAAATGATATAAGAAAGAAGGG + Intergenic
1099038630 12:77622098-77622120 GAAAATTGAATAGAAAAGGCAGG + Intergenic
1099727570 12:86452561-86452583 GTAAATTACACATGAAATACTGG + Intronic
1099967670 12:89467660-89467682 GAAAATGAAACAGTAAAGACAGG + Exonic
1100350897 12:93781366-93781388 ATAAAGTAAATAGGAAAGCAGGG - Intronic
1100571387 12:95846185-95846207 GTAAAGTAAACAGGATAGACTGG - Intergenic
1100903468 12:99270401-99270423 ATACATTAGATAGGAATGACTGG - Intronic
1101080781 12:101181640-101181662 GTAAATTAACAAAGCAAGACTGG + Intronic
1101221658 12:102647587-102647609 GGAAAATAATTAGGAGAGACAGG + Intergenic
1101353958 12:103959300-103959322 GTAAAATATATGAGAAAGACTGG + Intronic
1102920155 12:116785751-116785773 GAAAATAAAACAGGAAAGCCAGG + Intronic
1103148667 12:118617846-118617868 ATTAATTAAATATGAAAGAGAGG - Intergenic
1104226770 12:126842530-126842552 TTAAATTGCATAGGAAAGAAAGG + Intergenic
1104844470 12:131839957-131839979 AAAAATAAAATAGTAAAGACAGG + Intronic
1105418848 13:20235299-20235321 GTAATTTATAAAGAAAAGACAGG + Intergenic
1105989664 13:25606249-25606271 GCACATCAAATAGGAAAGGCAGG - Intronic
1106960802 13:34995150-34995172 GGATATTAAAAAGGAAAAACTGG + Intronic
1107077306 13:36336936-36336958 ATGAATTAAATGGGAAAAACTGG + Intronic
1108468698 13:50745817-50745839 GTCTATTTAATAGGAAAGACAGG + Intronic
1108848107 13:54699390-54699412 GAAAATATTATAGGAAAGACTGG + Intergenic
1109077511 13:57856001-57856023 GTAAATTAAATAGCTCAGAGAGG - Intergenic
1109516369 13:63448038-63448060 TTATTTTAAATAAGAAAGACTGG - Intergenic
1109724266 13:66318838-66318860 GTAATTTAAATAGGACAGTTTGG - Intronic
1109765275 13:66887284-66887306 GTAAACTAAAGAGGAATGAAAGG - Intronic
1110003021 13:70229703-70229725 GTAAATTTCACAGGAAAGAAAGG + Intergenic
1110437686 13:75493604-75493626 TTAATTTAAATATGAAATACTGG + Intergenic
1110468977 13:75836704-75836726 CTAAGTCAAATAAGAAAGACTGG + Intronic
1111468126 13:88644037-88644059 GAAAATGATATAGGAAAGACTGG - Intergenic
1112376117 13:98842935-98842957 CAAAATTAAAGAGTAAAGACAGG + Intronic
1113299815 13:109006225-109006247 ATAAAATAAATAAGAAAGACTGG - Intronic
1115151551 14:30292143-30292165 TTAAATAAAATAGAAAAGTCAGG + Intergenic
1115825546 14:37268347-37268369 GTAAAGTAAATAGTAGAGATTGG + Intronic
1116137271 14:40943121-40943143 GCACATAAAATAGGAAAAACTGG - Intergenic
1116288430 14:43002952-43002974 GAAAATGCAACAGGAAAGACTGG - Intergenic
1116596460 14:46853868-46853890 CTAAATTAAACTGGGAAGACAGG - Intronic
1118154673 14:63227449-63227471 ATAAATTACATAGGGAAGAGTGG - Intronic
1118204531 14:63710042-63710064 GTAACTTAAATATGGAAGGCAGG + Intronic
1118339589 14:64882987-64883009 ATAAATTAAAAAGTAAAGATTGG + Intergenic
1118699448 14:68418838-68418860 GGAAAGTAAAAAGGAAAGAAGGG + Intronic
1119306688 14:73613273-73613295 GAAACTTAAAAAGGAAAGACTGG - Intronic
1119751701 14:77083160-77083182 TTAAATGACATATGAAAGACAGG - Intergenic
1121185699 14:91966244-91966266 ATAAGTTAAAAAGTAAAGACTGG + Exonic
1121767196 14:96498221-96498243 ATAAATGAAATAGGAAATAGAGG - Intergenic
1122320678 14:100853596-100853618 GAAAATTAAATAGAAGAGGCAGG - Intergenic
1125051752 15:35306986-35307008 GAAAAGTAGATAGGAAAGTCTGG + Intronic
1126091640 15:45058141-45058163 GAAAATGTGATAGGAAAGACTGG + Intronic
1126391769 15:48163806-48163828 GTAAATGAAATAACAAAGCCTGG + Intronic
1126487513 15:49198781-49198803 GTAAAATAAAGAGAAAAGAAGGG - Intronic
1126494293 15:49273338-49273360 GTAAATAATACAGGAAAGAAAGG - Intronic
1126986959 15:54322726-54322748 GTAACTGAAATTGGCAAGACTGG + Intronic
1127718439 15:61674644-61674666 GTAAGTTGGATAGGGAAGACAGG - Intergenic
1130178035 15:81595386-81595408 GTTAATTAGACAGGAAATACTGG - Intergenic
1130925253 15:88380752-88380774 GATCCTTAAATAGGAAAGACAGG + Intergenic
1131624648 15:94104573-94104595 GTAATTTATAAAGGAAAGAAAGG - Intergenic
1131939322 15:97543470-97543492 GAAAATTAACTAGGAAATTCAGG - Intergenic
1134852144 16:17488556-17488578 GTAATTTATAAAGGAAAGAAAGG + Intergenic
1135096796 16:19571169-19571191 GTAAATAATATATGAAACACAGG - Intronic
1135266179 16:21027742-21027764 GCAATTTTAATAGGAAAGCCAGG + Intronic
1135282668 16:21166448-21166470 TTAAATTAAATTGGAAATCCAGG + Intronic
1135296798 16:21286716-21286738 TAAAATTATATAGGAAACACTGG - Intronic
1135564533 16:23501508-23501530 GAAAACTAAATAGAAAATACAGG - Intronic
1135946808 16:26872446-26872468 GAAAATAAATTAGGAGAGACAGG + Intergenic
1138783512 16:59817210-59817232 GAAAATTAATAAGGAAACACTGG + Intergenic
1138908704 16:61369727-61369749 GTAAATAAAGTAGAAAATACGGG + Intergenic
1139415395 16:66804117-66804139 GTATTTTAAATAGGAGAGTCAGG + Intronic
1139618781 16:68119680-68119702 GTTAATTTAATAGGAAAGTCTGG - Intronic
1140333413 16:74080304-74080326 GGAAACTAAAGAGGAAAGTCGGG + Intergenic
1140602525 16:76494644-76494666 CTAAATTAAATAGGAACTGCTGG + Intronic
1146150047 17:30459923-30459945 GTAAATAAAGGAGGGAAGACAGG - Intronic
1146356412 17:32138265-32138287 GTTAATATAATAGGAAAGGCTGG - Intergenic
1148629350 17:49094595-49094617 CAAGATTAAATAGGAAAGAATGG - Intergenic
1148811612 17:50296444-50296466 GTAAATTAAAGAAGACAAACAGG + Intergenic
1148934739 17:51155853-51155875 GAACTTTAAATAAGAAAGACGGG - Intronic
1149547450 17:57514402-57514424 GGAAATTAAACAAGAATGACAGG - Intronic
1149822833 17:59796271-59796293 GAAAACTAAATAGGACAGTCAGG - Intronic
1152403627 17:80083989-80084011 GAGAATTATATAGAAAAGACTGG + Intronic
1153710173 18:7790820-7790842 GTAAATTAAAAAGAAAAGGAAGG + Intronic
1154015602 18:10613980-10614002 CAAAAATAAATAGGAAAGAAAGG + Intergenic
1154189911 18:12221656-12221678 CAAAAATAAATAGGAAAGAAAGG - Intergenic
1154933726 18:21028615-21028637 AGAAATTAAATATGAAATACTGG + Intronic
1155361999 18:25012216-25012238 GTATATTAAAAAGAAAAGCCTGG - Intergenic
1155722780 18:29039534-29039556 GTAATTTATAAAGGAAAGAGAGG + Intergenic
1155743663 18:29323329-29323351 GTAAATAAAATATGAACAACAGG - Intergenic
1155760315 18:29557192-29557214 GTAAATTATATTGGGAAAACTGG + Intergenic
1156723890 18:40104138-40104160 GTAAATGACATAGAAAAGAGTGG - Intergenic
1157792826 18:50548094-50548116 GTAAGATAAATAAGAAAGAAAGG - Intergenic
1157917382 18:51679223-51679245 GTAATTTAGAAAGGAAAGACTGG - Intergenic
1158014092 18:52763786-52763808 TTATGTTAAATAGCAAAGACAGG - Intronic
1158085533 18:53646751-53646773 ATAAATGAAATAGAAAACACAGG + Intergenic
1158265895 18:55660392-55660414 GAAAATTAGTTTGGAAAGACAGG + Intronic
1158894062 18:61896915-61896937 GTTAATTAACTAGGGCAGACTGG + Intergenic
1158935764 18:62363294-62363316 ATTAATTAAAGAGGAAAGATGGG + Intronic
1159264287 18:66059794-66059816 GAAGATTAAAATGGAAAGACTGG + Intergenic
1159436029 18:68418507-68418529 GTAACTTAAATAGCAACAACAGG - Intergenic
1159532274 18:69669768-69669790 ATAAATTAAATAGGAATTTCCGG - Intronic
1159812119 18:73028217-73028239 GTAAAGTAAAAAAGAAAGACTGG + Intergenic
1160111449 18:76035971-76035993 ATAAATTAAATAAAAAAGAGAGG - Intergenic
1161157904 19:2743170-2743192 CTCACTAAAATAGGAAAGACTGG + Intergenic
1163229206 19:15988599-15988621 GAAAATTAAAAAGGAAAGACTGG - Intergenic
1165669704 19:37665185-37665207 GTTAATAAAAAAGGAAAGGCTGG + Intronic
1166077855 19:40424527-40424549 GTAAATAAATAAGGAAACACAGG + Intronic
1166642832 19:44509086-44509108 GGAAATTGAATAGGACAGAAAGG + Intronic
1168652441 19:58100249-58100271 TTAAAATAAACTGGAAAGACTGG - Intronic
925017475 2:542414-542436 GTAAAATAAAGAGGAGAGAAAGG + Intergenic
926875972 2:17479253-17479275 AGAAATTAAATAAGAAAGAAGGG + Intergenic
927065141 2:19463422-19463444 GTAACTTGCATAGGACAGACAGG + Intergenic
927631251 2:24776144-24776166 GTAAATTCAAGAATAAAGACCGG - Intergenic
927770596 2:25857673-25857695 GTGATTTAAATAGGATAGTCAGG - Intronic
929428000 2:41863559-41863581 GTAAAGTAAATAGGGCAGAGAGG - Intergenic
930339651 2:50096309-50096331 CTGAATTAAATAGTAAATACCGG - Intronic
931269765 2:60691106-60691128 GTAAGTTAGATAGCAAATACTGG + Intergenic
932155267 2:69411105-69411127 ATAAATTCATGAGGAAAGACTGG + Intronic
932509732 2:72273696-72273718 GAAAATTAAACTGGAAAGGCAGG + Intronic
933539557 2:83621063-83621085 GTAAGTTTAATAGGAATGTCTGG - Intergenic
933896896 2:86819512-86819534 GTAAATGGAATAGCAAAGCCTGG + Intronic
934512937 2:94962055-94962077 GTAAATTGAAGAGCAGAGACTGG - Intergenic
936738307 2:115473833-115473855 GTACATTACATAGCAATGACTGG + Intronic
937254159 2:120542870-120542892 GTAAATGAAAAAGTAGAGACAGG - Intergenic
937435564 2:121877607-121877629 CTAAAATAAATAAGGAAGACAGG - Intergenic
937628533 2:124071332-124071354 GTAAAATAAATAATAAAGATTGG + Intronic
938559989 2:132463552-132463574 GGAAATTAATAGGGAAAGACAGG + Intronic
939765594 2:146244937-146244959 GGAATTTAAATAAGAGAGACTGG + Intergenic
939867598 2:147490998-147491020 CTAAAGCAAATAGGAAAGTCTGG - Intergenic
939972087 2:148673879-148673901 GTAAATAAAATCAGAAAGCCAGG - Intronic
941356466 2:164499276-164499298 GTCAAGTAAATAGGGAACACAGG - Intronic
942077538 2:172370315-172370337 GAAAATAAAATAGGTAAAACAGG + Intergenic
942172243 2:173299772-173299794 ATAAATTCAATAGAAAAGTCTGG + Intergenic
942378610 2:175363279-175363301 GTGAGTTAAATCGGGAAGACAGG - Intergenic
942638798 2:178038549-178038571 GCAAATTCAATAGGAAAAAATGG + Intronic
943293867 2:186112314-186112336 GAAAATTAATAAGGAAACACTGG - Intergenic
944258695 2:197652697-197652719 GTTAATTATATAGCAAAGAAGGG + Intronic
944956769 2:204820918-204820940 GTAAATAAAATAGCAAAGCCTGG + Intronic
945021073 2:205572442-205572464 GGAAAATAAATTGGAGAGACAGG + Intronic
945726418 2:213476215-213476237 GAAAATGTGATAGGAAAGACTGG + Intronic
945915840 2:215703104-215703126 GCAAAGGAAAAAGGAAAGACAGG + Intergenic
946647220 2:221850694-221850716 GTGAATGAAAGAGGAAAGAAAGG + Intergenic
946721865 2:222617341-222617363 TTATATAAAATAGAAAAGACAGG + Intronic
948012441 2:234660402-234660424 GTTAATTAAATGGCAAAAACTGG + Intergenic
948255142 2:236562864-236562886 GGAAATTTAAAAGGAAAGAAAGG + Intergenic
949012419 2:241688597-241688619 GTAAATTAAAAAGGAAGAAAGGG - Intergenic
1169545705 20:6648512-6648534 GGAAATTAAACAGAAAAGAAAGG - Intergenic
1170739834 20:19046313-19046335 GTAATTTACAAAGGAAAGATAGG + Intergenic
1172919622 20:38470269-38470291 GTAAATAAAACAAAAAAGACTGG + Intergenic
1173381540 20:42548753-42548775 GAAAATTTAATAGAAAACACAGG + Intronic
1174189484 20:48730033-48730055 GAAGATTAAAGAGGAAAGACAGG + Intronic
1174806126 20:53605947-53605969 ATAAATAAAATAAGAAAAACAGG + Intronic
1177005802 21:15670469-15670491 GTAAAATATATATGCAAGACCGG - Intergenic
1177284243 21:19027660-19027682 CTAAATTAAATATTAAACACAGG - Intergenic
1177656358 21:24021330-24021352 GTAATTTATAAAGGAAAGAGAGG - Intergenic
1177683981 21:24412753-24412775 GTAATTTATAAGGGAAAGACTGG - Intergenic
1178252949 21:31021895-31021917 GAATAATAAATAGGAAAAACAGG + Intergenic
1178469162 21:32876282-32876304 GAAAATAGCATAGGAAAGACTGG + Intergenic
1178849577 21:36201696-36201718 CTAAATTAAAAAGCAAAGCCAGG + Intronic
1180937458 22:19635190-19635212 GAATATTAAACAAGAAAGACAGG + Intergenic
1181377554 22:22472083-22472105 ATAAAAAAAATAGCAAAGACTGG - Intergenic
1181392177 22:22591387-22591409 GCATATTTAATAGGAAAAACAGG - Intergenic
1182824370 22:33251649-33251671 GTAAATTAAGTTGGAAAAAGAGG + Intronic
1183113126 22:35667924-35667946 GAAAATTAAACCTGAAAGACTGG + Exonic
1184313158 22:43661767-43661789 TTATATTAAACAGGAAAGAGGGG + Intronic
949714378 3:6911632-6911654 GAAAAATAAATAGCAAAGATGGG - Intronic
950912924 3:16613920-16613942 GTAATTTTAGTAGGAGAGACGGG + Intronic
951811219 3:26702195-26702217 GTAAATAATATAGTAAAGGCTGG + Intronic
952638006 3:35555108-35555130 TTAAATAAAATATGAAACACTGG + Intergenic
953062934 3:39442883-39442905 ATAAACTAAAATGGAAAGACTGG + Intergenic
953147603 3:40293130-40293152 CTAAATTTAATCTGAAAGACTGG + Intergenic
954072435 3:48152583-48152605 GTAAATTAAATAAAAAAGAGGGG - Intergenic
955459180 3:59161715-59161737 GAAGATTAAATAAGAAAGAGTGG + Intergenic
955919439 3:63940048-63940070 AAAAAGTAAATAGGAAACACTGG + Intronic
956138099 3:66118702-66118724 TTCAATTAAATAGGAAAAATAGG - Intergenic
956250933 3:67232958-67232980 GTGTATTAAATAAGAAAGAATGG - Intergenic
957207618 3:77217892-77217914 GTAAATGAAATATTACAGACAGG + Intronic
957624545 3:82641749-82641771 AAAAAAAAAATAGGAAAGACTGG - Intergenic
957682426 3:83454163-83454185 GTATATTAAAAAGAAAATACAGG - Intergenic
957701848 3:83725601-83725623 GAAAATATGATAGGAAAGACTGG - Intergenic
957800370 3:85071185-85071207 GTAAAGTATATAGGTAAGATGGG + Intronic
958030839 3:88107363-88107385 GGAAATTAAATTGGAAAGAAAGG - Intronic
958544271 3:95521551-95521573 TAAAATTAAACAGGAAAGACAGG - Intergenic
958709791 3:97704051-97704073 ATGAATTAAATAGGAAAAAGTGG + Intronic
959217671 3:103473373-103473395 GAAAAGGAAATAGAAAAGACTGG - Intergenic
960016512 3:112895570-112895592 GTTAATTAAAAAGGAAAAACTGG + Intergenic
962246927 3:133803393-133803415 GTAATTTAAGTAGGAGTGACAGG - Intronic
962648929 3:137468253-137468275 GAAAATTAAAGACCAAAGACAGG - Intergenic
962667331 3:137668225-137668247 AAAACTTAAATATGAAAGACAGG - Intergenic
964600262 3:158492704-158492726 TTAATTTAAATAGGAAAAAGAGG - Intronic
964692034 3:159460806-159460828 GGAGATAAAATAGGAAAGACTGG + Intronic
965016025 3:163157774-163157796 GTAAATCAAAAAGTAAACACGGG + Intergenic
965057449 3:163740507-163740529 GAAAATTAATAAGGAAAAACTGG + Intergenic
965841150 3:172907006-172907028 GTAAAGTAAATAGGAGAGTTTGG + Intronic
965917761 3:173871994-173872016 GTAATTTAAATAATGAAGACTGG + Intronic
966012115 3:175092271-175092293 TTAAATTACATAGCAAAGCCAGG + Intronic
966051254 3:175619758-175619780 GAAAATGTGATAGGAAAGACTGG + Intronic
966486261 3:180474557-180474579 GTAATTTATAAAGGAAAGAGAGG + Intergenic
966753806 3:183349165-183349187 ATAAATGAAATAGAAAAGAGAGG - Intronic
967066810 3:185925086-185925108 TCAAATTAAATGGGAAAGTCAGG + Intronic
967293021 3:187940245-187940267 GTAAATTTAATAAGCAAGAGAGG + Intergenic
968192231 3:196677069-196677091 GTAAATAAAATTAGAAAGAGTGG + Intronic
968322946 3:197787571-197787593 GTAAAATAAACAGGAAGAACTGG + Exonic
968327577 3:197833063-197833085 GTAAATGAAATGGTAACGACAGG - Intronic
970704135 4:18779833-18779855 GTAAATTCAAAAGTAAAGGCTGG - Intergenic
970705497 4:18796829-18796851 GTAAACTAAATTTGAAAAACAGG - Intergenic
970969451 4:21964665-21964687 GAAAATCAAATAGGAATGAAGGG + Intergenic
973778039 4:54261452-54261474 GTACATTTAACAGGAGAGACAGG - Intronic
973925922 4:55737280-55737302 ACAAATAAAATAGGAAAGAGGGG - Intergenic
974875343 4:67697576-67697598 GAAAATGAGTTAGGAAAGACAGG - Intronic
975008685 4:69322134-69322156 GAAAATGCAATAGGAAAGGCTGG - Intronic
975708574 4:77135990-77136012 GAAAATAAAAAAGGAAAGAAAGG - Intergenic
975920179 4:79377524-79377546 ATAAATTAAAAAGGAAAGACAGG + Intergenic
976899020 4:90150293-90150315 GAAAAATAAATAGGAAACTCAGG - Intronic
977790925 4:101102210-101102232 GTAAATGAAGAAGGAAAGAAAGG + Intronic
978182680 4:105819069-105819091 GTACATTAAATATGAAAGCAAGG + Intronic
978687736 4:111467579-111467601 GTTAATTAAAAAGGAAATCCTGG - Intergenic
978688561 4:111479802-111479824 GGAAAGTAGATATGAAAGACTGG - Intergenic
979046638 4:115874014-115874036 GTAATTTATAAAGGAAAGAGGGG + Intergenic
979064976 4:116119412-116119434 GTAAATTAAATAATTATGACTGG + Intergenic
979746919 4:124227149-124227171 GAAAATTAATAAGGAAACACTGG + Intergenic
980191464 4:129530119-129530141 GAAAATTCAATAGGAAAGTCTGG - Intergenic
980299371 4:130967231-130967253 GTAAATGAAACAGCAAAGCCTGG + Intergenic
980382041 4:132034604-132034626 AGATATTAAATAGGAAAAACTGG + Intergenic
980491955 4:133540010-133540032 AAATATTAAATAGGAAAAACAGG - Intergenic
980877796 4:138679465-138679487 GTAAATTAAATGGAAAGGAAGGG + Intergenic
980987507 4:139710015-139710037 GAAAATTAAAAGGTAAAGACTGG + Intronic
981333953 4:143546298-143546320 GGAAAATTCATAGGAAAGACGGG - Intronic
981655289 4:147105509-147105531 GAAATTTCAAGAGGAAAGACTGG - Intergenic
982054224 4:151531386-151531408 GTAAATGTTATAGGAAAAACTGG - Intronic
982488579 4:155999684-155999706 GTATATTCAATGGGAAAGACAGG + Intergenic
983085670 4:163441566-163441588 AGAAATTAAAGAGGAAAGCCAGG + Intergenic
983733679 4:171030799-171030821 GTAAATTAAATTAAAAACACAGG + Intergenic
983918632 4:173319938-173319960 GGAAAGTAAATAAGAAAGCCTGG + Intronic
984405805 4:179328291-179328313 GTTAAATAAATAAGAAACACAGG - Intergenic
984562071 4:181282393-181282415 AAAAAAAAAATAGGAAAGACAGG + Intergenic
985170556 4:187144953-187144975 CTAAATAGAATAGGAAAGACAGG + Intergenic
986319602 5:6618763-6618785 GTATATTTTATAGTAAAGACTGG + Intronic
986526168 5:8679195-8679217 GTAAATTAAAAAAAAAAAACAGG - Intergenic
987373378 5:17213278-17213300 GGAAATTAAATAGGGAAGCAAGG + Intronic
987752979 5:22065748-22065770 GTAAATGCAATAGGAATCACTGG + Intronic
987942443 5:24558051-24558073 GTAAAATAAACAGGAAAAAGGGG + Intronic
988158573 5:27489034-27489056 ATAAATTATTTAGGAATGACTGG + Intergenic
988642233 5:33052825-33052847 GAAAATTAATAAGGAAATACTGG + Intergenic
990205871 5:53429052-53429074 TTAAAGAAAATAGGAAAGAAAGG - Intergenic
990229458 5:53696031-53696053 GAAAATTAATAAGGAAATACTGG + Intergenic
990541326 5:56775853-56775875 GAAAATTAAATAGGAGGGGCCGG + Intergenic
990545889 5:56820982-56821004 GAAAATTAAAAAGGAGATACGGG + Intronic
990644211 5:57825502-57825524 GTAAAGAGAATAGGAAAGAAAGG - Intergenic
990778563 5:59331976-59331998 GTAAATGAAATAGGAGAGCCAGG - Intronic
990854490 5:60248600-60248622 GCAAAGGAAATAGGACAGACTGG + Intronic
991276035 5:64847487-64847509 GAAAATTAATAAGGAAACACTGG + Intronic
992336615 5:75777127-75777149 GTAAAGCTAATAGTAAAGACTGG - Intergenic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
993096316 5:83482757-83482779 ATAAATTAAATGGCAAAGCCAGG + Intronic
993178619 5:84519797-84519819 GTGAAATAAATAGGAAAGTCTGG - Intergenic
993210608 5:84945844-84945866 GTAAATGACATTGGAAAAACTGG - Intergenic
993489222 5:88525835-88525857 TTAAATTAAATAATAAAGAAAGG - Intergenic
993702022 5:91130133-91130155 AAAAATTAAATAGGAAAAAAGGG + Intronic
993846509 5:92951113-92951135 GAAAATTAACAAGGAAACACTGG - Intergenic
993977308 5:94498146-94498168 GTAATTTAAACATCAAAGACTGG + Intronic
994043050 5:95279473-95279495 CTAAATTAAATAAGAAGGAATGG + Intronic
994087247 5:95772922-95772944 GTAAATTGAATATGAATGCCTGG + Intronic
994851840 5:105065386-105065408 GTAATTTTAATAGCAATGACAGG - Intergenic
995315511 5:110767338-110767360 GTAAATAAAAGAGAAAAGGCAGG - Intergenic
996091783 5:119358561-119358583 ATAGAATAAATAGGAAAGAAGGG + Intronic
996497148 5:124171761-124171783 GTAAATTAAGTATCAAAAACTGG - Intergenic
996507478 5:124284574-124284596 GTGATTTAAATAGGAAGGTCAGG + Intergenic
996815814 5:127571391-127571413 GTAAGTTTAATAGGATAAACAGG + Intergenic
998451897 5:142241152-142241174 GTTAATTAAATAGAAAAGAGTGG - Intergenic
998978771 5:147677334-147677356 TTAAATTGAATAAGAATGACAGG + Intronic
999864597 5:155686972-155686994 GTAAATTAGAAAAGAAATACAGG + Intergenic
1000195388 5:158952179-158952201 TTACAGTAAATAGGAAAGAAAGG + Intronic
1000803037 5:165752169-165752191 TTAAATTAAAAAAAAAAGACGGG - Intergenic
1001791473 5:174461000-174461022 GTAAATTAAACAAGGCAGACTGG + Intergenic
1002967840 6:1984847-1984869 GAAAATTAAAAAGGCATGACTGG + Intronic
1002982533 6:2154512-2154534 GCATATAAAATAGGAAAGAAAGG + Intronic
1003553160 6:7116888-7116910 TTACATTAAATAGGAGAGATGGG + Intronic
1004203074 6:13568136-13568158 ATAAATTAAATAGGAAAATGTGG + Intergenic
1004541791 6:16557534-16557556 GAAAAATAAACAGGAAAGAATGG + Intronic
1004738014 6:18427709-18427731 ATAACATAAATAGGAAAGAGGGG - Intronic
1005566032 6:27095556-27095578 GGAAACAAAATAGGAAAGATAGG + Intergenic
1006544402 6:34767647-34767669 CTAAATTAAATATGGGAGACTGG - Intronic
1006566044 6:34958321-34958343 ATAGATTCAATAGAAAAGACAGG - Intronic
1007000036 6:38302381-38302403 TTAAATGAAATAAGAAAGCCAGG - Intronic
1007884354 6:45209005-45209027 GTAAATGAAATAACAAAGCCTGG + Intronic
1009040796 6:58174631-58174653 GTAAATGAAATAACAAAGCCTGG - Intergenic
1009731424 6:67612908-67612930 GAGAATTATATAAGAAAGACTGG - Intergenic
1011543796 6:88463109-88463131 GGAAATTCAATTGGAAAGTCGGG + Intergenic
1012603656 6:101130848-101130870 GTAAACTAAAAAGGAAAGGCAGG + Intergenic
1012695158 6:102371691-102371713 GGAATTGAAAGAGGAAAGACTGG + Intergenic
1012982092 6:105841555-105841577 GTTAATTATATAGTAAATACTGG - Intergenic
1014766797 6:125416473-125416495 GTAGTTTAGTTAGGAAAGACTGG + Intergenic
1014948472 6:127525536-127525558 GTAATTTATAAAGGAAAGAGAGG + Intronic
1015014087 6:128388910-128388932 GGAGATTAAATAGGAAAGTAGGG - Intronic
1015171179 6:130255337-130255359 GAAAATTAATAAGGAAACACTGG - Intronic
1015434950 6:133174398-133174420 GTAGAGAAAAGAGGAAAGACTGG - Intergenic
1015726450 6:136304359-136304381 TTAAATTAAATTGGAATGTCAGG + Intergenic
1016520513 6:144941616-144941638 GACAATTAAATAGGAAATATTGG + Intergenic
1016612456 6:146006800-146006822 TTAAATGAAATAAGAAAGGCAGG + Intergenic
1017590012 6:155968552-155968574 GTAATTTATAAAGCAAAGACTGG - Intergenic
1017799644 6:157882202-157882224 GTAAATTGAATAGCCAAGCCTGG + Intronic
1018296331 6:162349165-162349187 GAAAATTAAAAAGGAATGACTGG + Intronic
1020722412 7:11764283-11764305 ATAAATTTAAAAGTAAAGACCGG + Intronic
1023647340 7:42331434-42331456 GAAAATTTAAAAGGAAAGACTGG + Intergenic
1023725436 7:43138420-43138442 GTAAATTAATTAGGAACCACCGG + Intronic
1023898764 7:44457631-44457653 GTAAATTATATATGTAATACAGG + Intronic
1024603397 7:51006528-51006550 GTGAATTCAACAGGAAACACTGG + Intergenic
1024687813 7:51766612-51766634 GTAAATTGAAAAGAAAAGAAAGG - Intergenic
1026506720 7:70990770-70990792 GTAACTTATATAGAAAAGAGAGG - Intergenic
1027409735 7:77903563-77903585 CTAAGTTAAATAGGGAACACGGG + Intronic
1027522456 7:79226661-79226683 GTAACTAAAATAGGAAGGAAGGG - Intronic
1029354110 7:100038418-100038440 GTAAATTTCTGAGGAAAGACAGG + Exonic
1030461115 7:109838237-109838259 GTAAGTTAAAAATGAAAGAAGGG + Intergenic
1031437277 7:121748421-121748443 GAAAATTAATTAGAAAAGAAGGG - Intergenic
1031581577 7:123481445-123481467 ATAAAAGAAATATGAAAGACGGG + Intronic
1033505758 7:141998058-141998080 CTAAATTAATTTGGAAAAACTGG - Intronic
1033604261 7:142914315-142914337 GGGCATTAAACAGGAAAGACTGG - Intronic
1034181050 7:149138257-149138279 GTATATTAAATAACAAAGGCAGG + Intronic
1034651961 7:152698466-152698488 GAAAAGTAAATAGGAAGGCCAGG - Intergenic
1035092313 7:156323866-156323888 GTAAATGAAATAACAAAGCCTGG - Intergenic
1035476351 7:159146335-159146357 GTAAATTACAGATGAAAGATAGG - Intergenic
1036122665 8:6035317-6035339 GCAAAATAATTAGGAAAGAAGGG + Intergenic
1036983465 8:13498262-13498284 GGAAATTCTATAGAAAAGACAGG + Intronic
1037379536 8:18269842-18269864 GTCAATTTATTAGGAAAGACTGG - Intergenic
1038248184 8:25878520-25878542 GCCAATTCAATGGGAAAGACAGG + Intronic
1038306844 8:26412285-26412307 CTGAATAAAATTGGAAAGACTGG + Exonic
1038933176 8:32218007-32218029 GTAAGGTATACAGGAAAGACTGG - Intronic
1039190995 8:34974068-34974090 GCAAATTAAAAAGGAAATCCAGG - Intergenic
1039954703 8:42198030-42198052 TTAAATTATATAGGAAAGCGAGG + Intronic
1040750018 8:50693564-50693586 GAAAATTAATAAGGAAATACTGG + Intronic
1040846879 8:51852749-51852771 TAAAATTAAAGAGGAGAGACTGG + Intronic
1041160013 8:55030925-55030947 GAAAATTAATAAGGAAATACTGG + Intergenic
1041390862 8:57346669-57346691 GTAAAATAAAGAGGTTAGACTGG - Intergenic
1041396787 8:57399840-57399862 GGAAATGGAAAAGGAAAGACAGG - Intergenic
1041480972 8:58319396-58319418 CTAAATTATAAAGGAAAGCCAGG + Intergenic
1042164537 8:65933064-65933086 GAGACTTAAATGGGAAAGACAGG + Intergenic
1042801638 8:72724234-72724256 GTAAATTAAATATGAGTGAGTGG + Intronic
1044267420 8:90199673-90199695 GTAAATTAAAAATGAAATTCTGG - Intergenic
1044564573 8:93649153-93649175 ATAAATTAAATAGAAAAGCTGGG - Intergenic
1044899820 8:96932250-96932272 GTAAATTATATAGGGAAGAAAGG - Intronic
1045684823 8:104701504-104701526 GTAAACCAAACAGGAAGGACTGG - Intronic
1046808099 8:118502494-118502516 GTTAATGAAATAGAAATGACAGG + Intronic
1050138903 9:2496871-2496893 GAAAATTATATAGTAAAAACGGG - Intergenic
1050147240 9:2582398-2582420 GATAATTAACAAGGAAAGACTGG + Intergenic
1050853301 9:10317232-10317254 TTAAATTAGATAGGTAATACAGG - Intronic
1051077366 9:13255755-13255777 GTAAATGGAAAAAGAAAGACTGG - Intronic
1051442629 9:17101972-17101994 GTAATTTAAAGAGAAAAGGCTGG - Intergenic
1051784775 9:20730351-20730373 ATAATTTATATAGGAAAGGCAGG + Intronic
1052143119 9:25012736-25012758 ATAAATTAAATAGGTAGAACTGG + Intergenic
1052478118 9:28988071-28988093 GAAAATTAATAAGGAAACACTGG - Intergenic
1052580941 9:30352782-30352804 GTAAATAAAATATGAAAGCCAGG - Intergenic
1052582890 9:30383952-30383974 GTGAATGAAATAGGAAGGAATGG - Intergenic
1053541513 9:38978830-38978852 TTGTATTAAATAGTAAAGACTGG + Intergenic
1053805932 9:41801874-41801896 TTGTATTAAATAGTAAAGACTGG + Intergenic
1054624626 9:67385076-67385098 TTGTATTAAATAGTAAAGACTGG - Intergenic
1054737407 9:68769313-68769335 GCAAATTAAGTAGGAAAAATGGG + Intronic
1055176412 9:73323389-73323411 GCAAATTAAAAATAAAAGACTGG - Intergenic
1056050616 9:82764634-82764656 GAAAATCAAATAGAATAGACTGG + Intergenic
1056669461 9:88612675-88612697 TTAAATTATATAGGAGAAACAGG + Intergenic
1056745486 9:89297757-89297779 TTAAATTTAATAGCAAACACAGG + Intergenic
1058016158 9:100034531-100034553 GCAAATTAATTAGGAAAGCAAGG - Intronic
1058466849 9:105237454-105237476 GTAATGTAGATAGGAAAAACTGG + Intergenic
1058575553 9:106397060-106397082 TTAAATTACATAGGCAAGTCTGG + Intergenic
1059381556 9:113931060-113931082 ATAGAAGAAATAGGAAAGACTGG + Intronic
1059726026 9:117008795-117008817 CTAACATCAATAGGAAAGACTGG + Intronic
1060328964 9:122647044-122647066 GAAAATTAACTAAGAAACACTGG + Intergenic
1185571807 X:1140400-1140422 GTAAGGTAAATATGAAAGAGGGG - Intergenic
1186162173 X:6788991-6789013 GTTAATTAAACAGAAGAGACCGG + Intergenic
1187404182 X:18987674-18987696 GGAAAGGAAAAAGGAAAGACTGG - Intergenic
1187541730 X:20203128-20203150 GTAAATTGAAGAGGAAAAAATGG + Intronic
1187546572 X:20259770-20259792 CTAAATTATACAGTAAAGACAGG + Intronic
1188892118 X:35624409-35624431 ATAAATTGAATGGGAAAGAAGGG - Intergenic
1188922483 X:35994315-35994337 ATAAATAAAATATGTAAGACAGG + Intergenic
1191184803 X:57598474-57598496 GTGGATTAGATGGGAAAGACCGG + Intergenic
1191577014 X:62717016-62717038 GTAAATAAAATATTAAATACAGG - Intergenic
1193093554 X:77521804-77521826 GTAAATTAAATAGGAAAGACTGG - Intronic
1193450994 X:81666092-81666114 GTAAATTAAAAAGCAAAAAATGG - Intergenic
1194100707 X:89700220-89700242 GAAAATGAAAGAGGAAAGAAGGG - Intergenic
1194120717 X:89960613-89960635 TTAAATTTAATCTGAAAGACTGG - Intergenic
1194220633 X:91184773-91184795 GAAAATCAAAAAGGAAATACTGG + Intergenic
1195051000 X:101096826-101096848 GTAAATAAAATTGGAAAGTTGGG - Intergenic
1195453233 X:105038936-105038958 GTATATTAGAGAGGACAGACAGG + Intronic
1195476067 X:105287240-105287262 GAGCATTAACTAGGAAAGACAGG + Intronic
1196687763 X:118526815-118526837 GAAAATTACATTGGAAGGACTGG + Intronic
1196976083 X:121159196-121159218 TAAAATTTAATAGGCAAGACAGG + Intergenic
1197456308 X:126680000-126680022 GTAAATGGAATAGCAAAGCCTGG - Intergenic
1199051502 X:143242050-143242072 GTAAATTACAAGTGAAAGACTGG + Intergenic
1199484426 X:148332811-148332833 ATAAAATAAAGAGGAAAGCCTGG + Intergenic
1200473581 Y:3618117-3618139 TTAAATTTAATCTGAAAGACTGG - Intergenic
1200557142 Y:4648525-4648547 GAAAATCAAAAAGGAAATACTGG + Intergenic
1200822747 Y:7604719-7604741 TTAAATTGAATAGCAAACACAGG - Intergenic
1201280770 Y:12340136-12340158 GCAAATGAAAGAGGAAAGAAAGG + Intergenic
1201797047 Y:17907029-17907051 GGAAATTAAAGTTGAAAGACTGG + Intergenic
1201804506 Y:17998956-17998978 GGAAATTAAAGTTGAAAGACTGG - Intergenic
1202237308 Y:22726370-22726392 TTAAATTGAATAGCAAACACAGG + Intergenic
1202358417 Y:24076088-24076110 GGAAATTAAAGTTGAAAGACTGG + Intergenic
1202512361 Y:25594025-25594047 GGAAATTAAAGTTGAAAGACTGG - Intergenic