ID: 1193094778

View in Genome Browser
Species Human (GRCh38)
Location X:77535402-77535424
Sequence ATCTAGTTCTTTAAGTGTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193094778_1193094779 9 Left 1193094778 X:77535402-77535424 CCTTAACACTTAAAGAACTAGAT 0: 1
1: 0
2: 1
3: 14
4: 222
Right 1193094779 X:77535434-77535456 AGCAATTTACCTTTAAAAATTGG 0: 1
1: 0
2: 2
3: 46
4: 462

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193094778 Original CRISPR ATCTAGTTCTTTAAGTGTTA AGG (reversed) Intronic
901280546 1:8030691-8030713 GTCTATTATTTTAAGTGTTAGGG + Intergenic
901661026 1:10797822-10797844 ATCTATTTCGTTTACTGTTATGG - Intergenic
906422487 1:45681998-45682020 ATCTACTTCTTTAAATAGTAAGG + Intronic
908734205 1:67258755-67258777 AACTGGTGGTTTAAGTGTTAAGG - Exonic
911543439 1:99186468-99186490 ATCTAGTTCATAAATTTTTAAGG + Intergenic
914189523 1:145396780-145396802 ATATAATACTTTAAGTCTTAGGG + Intronic
914913050 1:151802060-151802082 ATCCAGTTCTCTAAGCCTTAGGG + Exonic
915245790 1:154555626-154555648 AACTAGTTCTCTAAGCCTTATGG + Intronic
916508355 1:165448464-165448486 ATCTGGTTGTTTAAGAGTTTGGG + Intergenic
916752145 1:167732875-167732897 TTTTAGTTCTTTAAATGTTTTGG + Intronic
919261449 1:195199702-195199724 ATATAGTGCTTTAAATGATAAGG - Intergenic
921037363 1:211394129-211394151 ATTTAATACTTTAATTGTTATGG + Intergenic
921744246 1:218720176-218720198 ATATTCTTATTTAAGTGTTATGG + Intergenic
922408167 1:225340645-225340667 CTCTAGTTCTTCAAGAGTTATGG - Intronic
923974704 1:239249074-239249096 ATCTGGTTCATAAAGTGTTGTGG - Intergenic
924389157 1:243532814-243532836 TTTTATTTCTTTAAGAGTTACGG + Intronic
924636697 1:245795004-245795026 CTCTATTTCTTTATGTGTTTTGG + Intronic
1063242478 10:4185394-4185416 ATTTGGTTCTTTCACTGTTATGG - Intergenic
1064447259 10:15406784-15406806 ATCTGGTACTTTTAGTGTGAAGG + Intergenic
1067891369 10:50139272-50139294 ATTTAGTTCCTTAATTGTTGAGG + Intergenic
1068520023 10:58067564-58067586 ATCTAATTTTTTAAGTGTGACGG - Intergenic
1072085156 10:92071872-92071894 ATCCAGTTTTTTAAATGTAATGG - Intronic
1073167201 10:101466315-101466337 TTATATTTCTTTAAGTGTTTAGG + Intronic
1074174393 10:110981866-110981888 ATTTATTTTTTTAAGTTTTAGGG + Intronic
1076275143 10:129192244-129192266 ATGTACTTCTTTAATTGTTTGGG + Intergenic
1078820975 11:14881666-14881688 ATCTGGTTGTTTAAAAGTTAAGG + Intronic
1082064213 11:47885832-47885854 CTCTAGTTGTTTAACTCTTAAGG - Intergenic
1084136822 11:67189901-67189923 TTCTAGTTATTTAAGTTGTAAGG - Intronic
1087063607 11:94007369-94007391 CTCTAGTTCTTTTAATGTTAGGG + Intergenic
1088158572 11:106839988-106840010 ATATAATACTTTAAGTCTTAGGG - Intronic
1090964123 11:131583336-131583358 ATCTAGTTCTTTAGCTCTTGTGG + Intronic
1092554698 12:9544837-9544859 TTCTTCTTCTTTAAGTTTTAGGG - Intergenic
1093613942 12:21197638-21197660 ATATAGTGCCTTAAGTATTATGG + Intronic
1095090202 12:38097443-38097465 TTTTAATTCTTTAAGTTTTAGGG - Intergenic
1095136967 12:38616319-38616341 TTTAAGTTCTTTAAGTTTTAGGG + Intergenic
1096877494 12:54641878-54641900 ATCTAATTCTCAAAATGTTAAGG - Intergenic
1097657296 12:62382169-62382191 ATATAGTTCTTAAACTTTTAAGG + Intronic
1098124365 12:67274753-67274775 ATTTATTTATTTAAGTGTTTTGG + Intronic
1098437860 12:70486940-70486962 ATCTAGATCTTTAAAAATTAAGG - Intergenic
1099943161 12:89214265-89214287 ATGTTGTACTTTAAATGTTATGG - Intergenic
1102777620 12:115534321-115534343 ATCTATTTCTTTAAGAAATAAGG - Intergenic
1103086403 12:118064184-118064206 ATCCAGGTCTTCAAGTTTTAAGG - Exonic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1103982101 12:124743149-124743171 ATTTATTTCTTTAATTGTTTTGG - Intergenic
1107247431 13:38312831-38312853 ATGTAGTTTTCTAAGTTTTATGG - Intergenic
1107279049 13:38712193-38712215 ATCTAGTTCTTAAACTCTCAGGG - Intronic
1108445309 13:50503048-50503070 TTTTAATACTTTAAGTGTTAGGG + Intronic
1109204937 13:59471992-59472014 TATTAGTTCTTTAAGTGTTTGGG - Intergenic
1109413532 13:62006028-62006050 ATCTAGTTGTTTATTTGTGATGG - Intergenic
1109488994 13:63069850-63069872 ATATAGTTATTTATATGTTAGGG - Intergenic
1109549682 13:63877263-63877285 ATTTTGTTTTTTAAGTGGTAAGG + Intergenic
1109882488 13:68498513-68498535 TTATATTTCTTTATGTGTTAAGG - Intergenic
1110393197 13:75000005-75000027 ATGTATTTTTTTAAGTTTTAGGG - Intergenic
1110971175 13:81763482-81763504 CTCAAATTCTTTAACTGTTAAGG + Intergenic
1111822681 13:93232661-93232683 ATTATGTTCTTTAAGTATTATGG + Intronic
1114354578 14:21893203-21893225 ATTTGGTTTTTTAAGTTTTAGGG + Intergenic
1114853324 14:26406997-26407019 ATCTAGGTCTTTAAATCTTGAGG - Intergenic
1118163701 14:63315825-63315847 ATCTTGTTCTTTAACGGTTTTGG + Intronic
1120139017 14:80906712-80906734 ATGTAGCTCTTTAAGTCTAAAGG - Intronic
1120413549 14:84190811-84190833 ATCTATTTTTGTAAGTGTAAGGG - Intergenic
1122354662 14:101115709-101115731 ATCTATTTTTTGAAGTGTAATGG + Intergenic
1122742946 14:103882276-103882298 GTCAAGTTCTTTAAGAGTTTAGG - Intergenic
1123159774 14:106267187-106267209 TTCTTGTACTTTAAGTTTTAGGG - Intergenic
1123958897 15:25373055-25373077 AATTAGTTCTTAAAGAGTTAAGG - Intronic
1124889925 15:33723411-33723433 ATGTTGTTATTTAAATGTTAAGG + Intronic
1125834743 15:42738952-42738974 ATCTAGTTCTGTTTGTGTGATGG - Exonic
1126365387 15:47888820-47888842 ATATTGTTCTTTATGTGTGATGG + Intergenic
1126522085 15:49606380-49606402 AGCTAGGTTTTTAATTGTTAGGG - Intronic
1128833158 15:70787637-70787659 ATGTTGTTCTTTAAGAGTAAGGG + Intergenic
1129614998 15:77091516-77091538 ATCTAGGTATTTATGTGTTTTGG + Intergenic
1136603591 16:31315154-31315176 ATTGAGTTCTTTATGTGTTATGG + Intronic
1138883448 16:61045841-61045863 ATCTATTGCTTTATGTGTAAAGG + Intergenic
1139293919 16:65883264-65883286 ATGTAGTTCTTTATGTATTCTGG - Intergenic
1140167276 16:72565519-72565541 ATTTATTTATTTTAGTGTTAAGG - Intergenic
1140787714 16:78359654-78359676 ATTTATTTTTTTAAATGTTACGG - Intronic
1144274797 17:13656039-13656061 ATCTAGTTGTTTAAAAGTTTGGG + Intergenic
1146726525 17:35160816-35160838 ATCAACTTCTTTGATTGTTAAGG + Intronic
1151072315 17:71229502-71229524 TCCTTGTTCTTTAACTGTTATGG - Intergenic
1156656490 18:39294603-39294625 TTCTAGTTTTTTAAGTTTCAGGG - Intergenic
1156722766 18:40090299-40090321 ATCAAGTGCGATAAGTGTTAGGG + Intergenic
1156723994 18:40105471-40105493 ATGTAGTTCCTTAAGTGAAAGGG + Intergenic
1157168268 18:45378602-45378624 AACTAATTTTTTAAGTCTTATGG - Intronic
1159367030 18:67480379-67480401 TGATAGTTCTTTAAGTATTATGG - Intergenic
1160209645 18:76866265-76866287 ATCAGGTTCTGTAAGTGTTGAGG + Intronic
1162667122 19:12223296-12223318 AACTAGTTCTTTGTGTTTTATGG + Intergenic
1166178542 19:41091098-41091120 ATCTAGATATTTATGTGTTTAGG - Intronic
926845483 2:17133041-17133063 ATCTAGTTTTTAAAGTTTTCTGG - Intergenic
926975114 2:18507463-18507485 ATGTAGTTCTTTAAATGTTCTGG + Intergenic
928911770 2:36429143-36429165 ATTTAATTCTATAAATGTTATGG - Intronic
928961856 2:36934651-36934673 ATGTAGTTCCTTAAGATTTATGG - Intronic
929415294 2:41741059-41741081 CTCAACTTCTTTAAGTTTTAGGG - Intergenic
930126526 2:47802262-47802284 ATTTTGTTCTTTAAATGTCACGG + Intronic
930759075 2:55012370-55012392 ATCTACTTCTTTAATTTTTATGG + Intronic
931203937 2:60128631-60128653 ATCTAGTTTGTTAAGTAGTAGGG - Intergenic
937029069 2:118723107-118723129 ATGTATTACTTTAAGTGTTTAGG + Intergenic
938389790 2:130895928-130895950 ATTTATTTCTATGAGTGTTATGG + Intronic
939548183 2:143579891-143579913 ATTTATTTATTTAAGTTTTAGGG + Intronic
939572556 2:143857653-143857675 ATCCAGTTCAATAAGTGCTATGG - Intergenic
939787544 2:146536333-146536355 ATCTGGTTGTTTAAGAGTTAGGG - Intergenic
939951130 2:148474645-148474667 ATGTATATCTTTAAGAGTTAAGG - Intronic
940737445 2:157469379-157469401 ATCTAGTTCTAGAAGTATGAAGG + Intronic
941011653 2:160307011-160307033 ATCTAGTTTTCTACTTGTTATGG - Intronic
941461471 2:165777510-165777532 ATCTACTGGTTAAAGTGTTAGGG + Intronic
941776298 2:169397176-169397198 ATCTAGCTCTTTTAGTGAAATGG - Intergenic
942846356 2:180430520-180430542 ATCAATTACTTTAAGTATTATGG - Intergenic
943178385 2:184508683-184508705 TTCTAATTTTTTAAGTGTTAAGG - Intergenic
943741089 2:191410043-191410065 ATCTAGTTCCTTATGTTGTATGG - Intronic
945846153 2:214947597-214947619 ATTTAGTGCTTTAAGGGTTTTGG - Intronic
947005191 2:225503340-225503362 TTCTACTTCTTGAAGTGTCATGG - Intronic
948367144 2:237464151-237464173 ATGTAATACTTTAAGTTTTAGGG - Intergenic
1173629830 20:44504261-44504283 TTTTAATTCTTTAAGTGTCAAGG + Intronic
1174580555 20:51568495-51568517 ATCTACTTCTTAGAGTGATATGG + Intergenic
1174681094 20:52409205-52409227 ATGTAGTTCTTTAGGTGAGAGGG + Intergenic
1174942482 20:54945330-54945352 TTCTAGTTCTTCAAGTTGTAGGG + Intergenic
1176911797 21:14574505-14574527 ATCTAGTTATAGAATTGTTATGG - Intronic
1178782499 21:35617439-35617461 ATGTATTTATTTAAGTCTTATGG - Intronic
1179630619 21:42676002-42676024 ATCTGGTTGTTTATGTGTGAAGG + Intronic
1182876798 22:33698901-33698923 ATTGAGTCATTTAAGTGTTACGG - Intronic
949202269 3:1393537-1393559 TTTTACTTCTTTAAGTTTTAGGG - Intronic
949624415 3:5850864-5850886 TTGTAGTTCTTTAACTGTTTGGG + Intergenic
950741473 3:15055865-15055887 GTCGAGTTCTTTATGTGTTCTGG - Intronic
958803574 3:98783241-98783263 AGCTAGTTCTCTAAATGTTCTGG + Intronic
960901496 3:122558626-122558648 ATTTAGTATTTTAAGTGTTTCGG - Intronic
961199845 3:125036597-125036619 AAAAAGTTCTTTATGTGTTAAGG - Intronic
962354626 3:134683291-134683313 ATCTAATTCTGTGAGTGTGAAGG + Intronic
962417366 3:135195345-135195367 ATTTATTTATTTAAGTTTTAGGG + Intronic
963003967 3:140708704-140708726 TTCTAGTCCTTTAAGTCTCAAGG - Intergenic
963095566 3:141535729-141535751 ATCTAGTTGTTTAAGAGTCTGGG - Intronic
963499082 3:146101922-146101944 ATCTACTTCTTTCAGTTTGATGG + Intronic
963596534 3:147334352-147334374 ATTTATTTCTTTTAGTTTTAAGG - Intergenic
965268128 3:166574647-166574669 ATCTAGTTATTAAAGATTTAGGG + Intergenic
967445207 3:189557552-189557574 ATATAGTTGTTTAGGTTTTATGG - Intergenic
969093379 4:4713691-4713713 CTCTTGTTTTTTTAGTGTTAGGG - Intergenic
969644447 4:8419126-8419148 ATCTGGTTCTTTAAGAGATAAGG - Intronic
972722428 4:41713613-41713635 ATCTGGTTGTTTAAGTGTCTGGG - Intergenic
972776958 4:42250228-42250250 TTTTAATTCTTTAAGTTTTAGGG + Intergenic
973295461 4:48515072-48515094 ATCTAGCTCTTTCAGAGCTAAGG + Exonic
974438537 4:61887295-61887317 AGCTTCTTCTTAAAGTGTTAAGG + Intronic
976502140 4:85803549-85803571 ATCTATTTCCTTATGTTTTATGG + Intronic
978617803 4:110613324-110613346 ACCTAGTTCTTCTAGTCTTACGG - Intergenic
978820526 4:112959300-112959322 ATCTGCTTCATTAAGGGTTAAGG - Intronic
979460460 4:120977132-120977154 ATCTAGTTTAAGAAGTGTTAAGG - Intergenic
979684768 4:123499725-123499747 AGCTATTTCTTTAAGTCTTTAGG + Intergenic
980462380 4:133132387-133132409 ACCTAGATCTTTAAGAGTAAGGG - Intergenic
983057966 4:163121722-163121744 ATGTACTTCTATAAGTGCTAAGG - Intronic
983280183 4:165671015-165671037 TTCTATTTCTTTGTGTGTTATGG + Intergenic
985242380 4:187944221-187944243 ATCCAGTTCTTGAAGGATTAAGG - Intergenic
985919211 5:2956534-2956556 ATCTACTTCTTTCAATTTTATGG + Intergenic
986140100 5:5021496-5021518 ATCTAGATCTTTAACTGATATGG - Intergenic
987791713 5:22576579-22576601 TTCTAGTTCTTTCAGTGTTAAGG - Intronic
988821823 5:34894354-34894376 ATGTAGAGCTTTAAGTGTCATGG + Intronic
989363421 5:40629290-40629312 TTATACTTCTTTAAGTTTTAGGG + Intergenic
989609323 5:43276374-43276396 ATCTGGTTCTTTAAAAGTGATGG - Intronic
989738242 5:44734580-44734602 AACTAGTTCTTTAAATATTAAGG + Intergenic
990090053 5:52032933-52032955 ATCTAGTTCCTCAAGTGAGAGGG + Intronic
991541657 5:67736911-67736933 TTATACTTCTTTAAGTTTTAGGG + Intergenic
991643425 5:68776873-68776895 ATCTAGATATTTAAATGATAAGG - Intergenic
991960976 5:72043786-72043808 GTCCAGTTCTTGAAGTGTCAAGG + Intergenic
993196463 5:84753703-84753725 TTCTAATTCTTTATGTTTTATGG - Intergenic
994153977 5:96481569-96481591 AGATAGTTCCTGAAGTGTTATGG - Intergenic
998694475 5:144623825-144623847 ATTTATTTATTTAAGTTTTAGGG + Intergenic
998984143 5:147736534-147736556 ATAATGTTCTTTAAGTGATATGG - Intronic
1000101274 5:158019156-158019178 TTCTAGTTCTTTATGTGCTAGGG + Intergenic
1000950416 5:167475203-167475225 ATTTAATTCTTTAACAGTTAAGG - Intronic
1003755712 6:9117373-9117395 TCCTATTTCTTAAAGTGTTATGG - Intergenic
1003933933 6:10956251-10956273 CTCTAGTTTTTTAAGTTTTGTGG - Intronic
1004814943 6:19302686-19302708 TTCTTGCTCTGTAAGTGTTAAGG + Intergenic
1006761736 6:36467822-36467844 ATCTAGTTCATTCATTTTTAAGG - Intronic
1007801100 6:44394090-44394112 ATTAAGTTAATTAAGTGTTACGG + Intronic
1009255875 6:61397354-61397376 ATTTAGTGCTTTGAGTCTTATGG + Intergenic
1009601221 6:65802725-65802747 ATATGGTCATTTAAGTGTTAAGG + Intergenic
1011919368 6:92552313-92552335 AACCAGTTATTTAAGTGTAAAGG + Intergenic
1012247540 6:96942549-96942571 AGCTATGTCTTGAAGTGTTAAGG + Intronic
1015639426 6:135315012-135315034 ATCTAGTTTTTTAACTGGTTTGG + Intronic
1015750875 6:136557560-136557582 ATCTATTTCTATAATTTTTAAGG - Exonic
1016683566 6:146857039-146857061 TTATTGTACTTTAAGTGTTAGGG - Intergenic
1020482503 7:8679270-8679292 AACTATTTCTTAAAATGTTAGGG - Intronic
1020706895 7:11556076-11556098 ATGTAGTTATTTATATGTTATGG + Intronic
1024164956 7:46721673-46721695 ATCTGGTTGTTTAAGTGTGTGGG + Intronic
1024646508 7:51375549-51375571 AACAAGGTCTTTAAGTTTTAAGG - Intergenic
1024816839 7:53281506-53281528 TTCTATTTCTTTAAGTTTTGGGG - Intergenic
1024818285 7:53296482-53296504 ATCTATTTCTTTTACTCTTAAGG - Intergenic
1025138778 7:56444793-56444815 GTTGAGTTCTTTAAGTTTTAAGG - Intergenic
1028257554 7:88618615-88618637 ATCTACTTCTGTACGTGTTTAGG + Intergenic
1028838630 7:95401540-95401562 TTCTAGTTCTTCATGTGTAAAGG - Intergenic
1028968111 7:96825569-96825591 AGAAAGTTCTTTAATTGTTAAGG - Intergenic
1031687026 7:124743356-124743378 ATCCATTTCTTTAAGAATTATGG - Intergenic
1031707769 7:125003454-125003476 AACTAGTTTTTTAAGTATTTGGG - Intergenic
1032290897 7:130590161-130590183 CTCTACTTCTTTAAATGTTCAGG + Intronic
1037431968 8:18823115-18823137 TTCTAGTTATTGAAGTGATAAGG - Intronic
1038257075 8:25959876-25959898 ACCTAGTCCTTTAAGTATTTGGG - Intronic
1038543193 8:28406055-28406077 ATTTAATTCTGTAAGTTTTAGGG - Intronic
1039988163 8:42465374-42465396 ATCTTTTTCTTCAAATGTTAAGG - Intronic
1041037042 8:53803026-53803048 CTCTACTTCTTAAAGTCTTAAGG - Intronic
1041373271 8:57187247-57187269 ATTTAGTTCTTTAAATATTCTGG - Intergenic
1043277812 8:78422118-78422140 ATCTAGTAATTTTAGTGTTTAGG + Intergenic
1044365224 8:91337105-91337127 ATCTTTTTCTTTAAGTCTTCAGG + Intronic
1046520112 8:115313845-115313867 ATCTAGTTCTTTAAGCTCTTGGG - Intergenic
1048146892 8:131853920-131853942 ATCTGGTTGTTTAAGTTTTAGGG + Intergenic
1048382221 8:133875899-133875921 TTGTAGTTCTTTATGTGTTCTGG + Intergenic
1050728068 9:8675247-8675269 CTCTAGTTCCTCAAGTGTGAGGG + Intronic
1051265947 9:15308047-15308069 AGCTAGATCTTTAAGAGTTTGGG + Intergenic
1052135167 9:24900207-24900229 ATCTTGTTCTTTATGTTTTGGGG - Intergenic
1055762975 9:79629526-79629548 AGTTAGTTCTTTAAGTTTTTAGG - Intronic
1057736149 9:97663172-97663194 ATCTAATTCTTTCAGTGCTATGG + Intronic
1059600975 9:115778488-115778510 ATATAGTTTGTAAAGTGTTAAGG + Intergenic
1187286632 X:17911187-17911209 TTTTAGTGCTTTAAGTGGTATGG + Intergenic
1190187514 X:48248860-48248882 ATCTAGTTCTTTATGATTTCAGG - Intronic
1190192005 X:48285024-48285046 ATCTAGTTCTTTATGATTTCAGG - Intergenic
1190522124 X:51291002-51291024 ATCCAATTATTTAAGTGTTTGGG + Intergenic
1190525353 X:51324105-51324127 ATCCAATTATTTAAGTGTTTAGG + Intergenic
1190531212 X:51378510-51378532 TTCTAGTTCTTTAAGGTGTAAGG - Intergenic
1190722414 X:53160972-53160994 ATCTAGCTTCTTATGTGTTAGGG + Intergenic
1191026909 X:55923685-55923707 ACGTGGATCTTTAAGTGTTATGG - Intergenic
1191081155 X:56511038-56511060 CTCTAGTTCTTTAAATTTTGAGG - Intergenic
1193094778 X:77535402-77535424 ATCTAGTTCTTTAAGTGTTAAGG - Intronic
1193292130 X:79787438-79787460 TTCTATTTTTTTAAGTGTCATGG - Intergenic
1193321046 X:80121798-80121820 ATCTACTTTCTTAGGTGTTAGGG - Intergenic
1193495214 X:82202562-82202584 TTATTGTTCTTTAAGTTTTAGGG - Intergenic
1193495946 X:82213134-82213156 ATATATTTCTTTAATTTTTAAGG + Intergenic
1196500021 X:116369827-116369849 ATGTAATTCTTTATATGTTATGG + Intergenic
1197086811 X:122487124-122487146 ATCTAGTGCTTTATCTGTTTTGG + Intergenic
1197501671 X:127250475-127250497 TTATACTTCTTTAAGTTTTAGGG + Intergenic
1197710052 X:129659550-129659572 ACCTAATTTTTTAAGTGCTAAGG + Intergenic
1199929970 X:152507983-152508005 ATAAAGTTCTTTTAGTGTTCTGG + Intergenic
1202278532 Y:23150889-23150911 ATGTAGTTCTATAGATGTTATGG + Intronic
1202278687 Y:23153264-23153286 ATGTAGTTCTATAGATGTTATGG + Intronic
1202286051 Y:23248345-23248367 ATGTAGTTCTATAGATGTTATGG - Intronic
1202286516 Y:23255500-23255522 ATGTAGTTCTATAGATGTTATGG - Intronic
1202286671 Y:23257877-23257899 ATGTAGTTCTATAGATGTTATGG - Intronic
1202431356 Y:24782228-24782250 ATGTAGTTCTATAGATGTTATGG + Intronic
1202431511 Y:24784604-24784626 ATGTAGTTCTATAGATGTTATGG + Intronic
1202431814 Y:24789361-24789383 ATGTAGTTCTATAGATGTTATGG + Intronic
1202432117 Y:24794117-24794139 ATGTAGTTCTATAGATGTTATGG + Intronic
1202438151 Y:24868801-24868823 ATGTAGTTCTATAGATGTTATGG - Intronic
1202438454 Y:24873558-24873580 ATGTAGTTCTATAGATGTTATGG - Intronic
1202438610 Y:24875934-24875956 ATGTAGTTCTATAGATGTTATGG - Intronic
1202587242 Y:26444260-26444282 ATGTAGTTCCTTAAGATTTATGG + Intergenic